Incidental Mutation 'R5304:Fermt1'
ID404404
Institutional Source Beutler Lab
Gene Symbol Fermt1
Ensembl Gene ENSMUSG00000027356
Gene Namefermitin family member 1
SynonymsKindlin-1, 5830467P10Rik
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5304 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132904389-132945906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132942066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 8 (T8S)
Ref Sequence ENSEMBL: ENSMUSP00000047616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038280]
PDB Structure
Solution Structure of the N-terminal domain of kindlin-1 [SOLUTION NMR]
Structural and functional characterisation of the kindlin-1 pleckstrin homology domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000038280
AA Change: T8S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047616
Gene: ENSMUSG00000027356
AA Change: T8S

DomainStartEndE-ValueType
Blast:B41 10 74 2e-16 BLAST
B41 91 570 1.39e-30 SMART
PH 370 475 2.81e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144342
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fermitin family, and contains a FERM domain and a pleckstrin homology domain. The encoded protein is involved in integrin signaling and linkage of the actin cytoskeleton to the extracellular matrix. Mutations in this gene have been linked to Kindler syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality within 5 days of birth, dehydration, detachment of colonic epithelial cells, and colonic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Fermt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Fermt1 APN 2 132941951 missense probably damaging 1.00
IGL02511:Fermt1 APN 2 132933166 splice site probably benign
IGL02591:Fermt1 APN 2 132934866 missense possibly damaging 0.89
IGL03107:Fermt1 APN 2 132933139 missense probably damaging 1.00
R0691:Fermt1 UTSW 2 132906733 missense probably damaging 0.99
R1386:Fermt1 UTSW 2 132916058 missense probably damaging 0.99
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1468:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1474:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1510:Fermt1 UTSW 2 132925022 missense probably benign 0.16
R1558:Fermt1 UTSW 2 132934819 critical splice donor site probably null
R1625:Fermt1 UTSW 2 132922831 missense probably damaging 1.00
R1917:Fermt1 UTSW 2 132922842 missense probably damaging 1.00
R2026:Fermt1 UTSW 2 132918525 missense probably benign 0.11
R2264:Fermt1 UTSW 2 132915190 critical splice donor site probably null
R2512:Fermt1 UTSW 2 132939518 splice site probably null
R3765:Fermt1 UTSW 2 132906702 missense possibly damaging 0.55
R4914:Fermt1 UTSW 2 132906840 missense probably damaging 1.00
R5184:Fermt1 UTSW 2 132941963 missense possibly damaging 0.50
R5259:Fermt1 UTSW 2 132906765 missense probably damaging 0.99
R5303:Fermt1 UTSW 2 132911339 intron probably null
R5404:Fermt1 UTSW 2 132934869 missense possibly damaging 0.55
R5569:Fermt1 UTSW 2 132915203 missense possibly damaging 0.89
R7146:Fermt1 UTSW 2 132934865 missense probably benign 0.02
X0013:Fermt1 UTSW 2 132918586 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAACACAGAGGGGTTCAAACAC -3'
(R):5'- AGGTATCAGTAACCTTACAGAGTTC -3'

Sequencing Primer
(F):5'- GTTCAAACACAGAAAACCATGGTG -3'
(R):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
Posted On2016-07-22