Incidental Mutation 'R5304:Vgf'
ID404420
Institutional Source Beutler Lab
Gene Symbol Vgf
Ensembl Gene ENSMUSG00000037428
Gene NameVGF nerve growth factor inducible
SynonymsLOC381677
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5304 (G1)
Quality Score175
Status Validated
Chromosome5
Chromosomal Location137026392-137033351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137032286 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 434 (D434V)
Ref Sequence ENSEMBL: ENSMUSP00000140815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041543] [ENSMUST00000111080] [ENSMUST00000186451] [ENSMUST00000187382] [ENSMUST00000190827]
Predicted Effect probably damaging
Transcript: ENSMUST00000041543
AA Change: D434V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048273
Gene: ENSMUSG00000037428
AA Change: D434V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111080
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154183
Predicted Effect probably damaging
Transcript: ENSMUST00000186451
AA Change: D434V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140735
Gene: ENSMUSG00000037428
AA Change: D434V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187382
SMART Domains Protein: ENSMUSP00000140093
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190827
AA Change: D434V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140815
Gene: ENSMUSG00000037428
AA Change: D434V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small, lean, hyperactive, hypermetabolic, and infertile. Mutants exhibit markedly reduced leptin levels and altered hypothalamic proopiomelanocortin, neuropeptide Y, and agouti-related peptide expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Plin4 T A 17: 56,106,132 T498S probably benign Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Vgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Vgf UTSW 5 137031482 unclassified probably benign
R1832:Vgf UTSW 5 137031299 missense possibly damaging 0.46
R1960:Vgf UTSW 5 137032175 unclassified probably benign
R2256:Vgf UTSW 5 137031547 unclassified probably benign
R3433:Vgf UTSW 5 137031019 missense probably benign 0.27
R4751:Vgf UTSW 5 137032401 missense probably damaging 0.99
R6874:Vgf UTSW 5 137031532 unclassified probably benign
R6944:Vgf UTSW 5 137032352 missense probably damaging 0.99
R6969:Vgf UTSW 5 137031653 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCCAGTATCTGTTGCAGG -3'
(R):5'- TTCCAGTCCGGCAACTCATC -3'

Sequencing Primer
(F):5'- ATCTGTTGCAGGGCGGAG -3'
(R):5'- CAACTCATCCCGGGCTG -3'
Posted On2016-07-22