Incidental Mutation 'R5304:Plin4'
ID404467
Institutional Source Beutler Lab
Gene Symbol Plin4
Ensembl Gene ENSMUSG00000002831
Gene Nameperilipin 4
SynonymsS3-12
MMRRC Submission 042887-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5304 (G1)
Quality Score213
Status Validated
Chromosome17
Chromosomal Location56100591-56109803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56106132 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 498 (T498S)
Ref Sequence ENSEMBL: ENSMUSP00000139859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000190703]
Predicted Effect probably benign
Transcript: ENSMUST00000002908
AA Change: T498S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831
AA Change: T498S

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190703
AA Change: T498S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831
AA Change: T498S

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN4, coat intracellular lipid storage droplets (Wolins et al., 2003 [PubMed 12840023]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased triglyceride in the heart and protection from cardiac steatosis induced by prolonged fasting, feeding or genetic obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,232 T49S probably benign Het
Adcy1 C T 11: 7,064,198 A200V probably benign Het
Adgrv1 T C 13: 81,578,253 D551G possibly damaging Het
Aldh3a2 A G 11: 61,253,712 V340A probably damaging Het
Amy1 C A 3: 113,558,364 C393F probably damaging Het
Ankrd16 T C 2: 11,789,734 V310A probably benign Het
Arhgef15 T C 11: 68,947,237 S686G probably null Het
Arid4b T A 13: 14,186,929 N659K probably benign Het
Asz1 C T 6: 18,076,620 R191Q probably benign Het
Atp2a3 A G 11: 72,988,557 I947V probably damaging Het
AW011738 G A 4: 156,203,512 probably benign Het
Bfsp1 G T 2: 143,827,291 T456K probably benign Het
Cdc25c T C 18: 34,750,811 T40A possibly damaging Het
Cdh7 G A 1: 110,108,839 C583Y probably damaging Het
Cfap54 A T 10: 92,821,106 L3028Q probably damaging Het
Chd1 A G 17: 15,754,951 S1088G probably benign Het
Chd1 A T 17: 15,770,268 H1694L possibly damaging Het
Cstf3 G T 2: 104,663,390 E580* probably null Het
Dip2a A T 10: 76,294,523 M622K possibly damaging Het
Dlgap1 A T 17: 70,815,207 H877L probably damaging Het
Egfr G T 11: 16,884,260 M122I probably benign Het
Etfbkmt T A 6: 149,147,206 D114E probably damaging Het
Eva1c T C 16: 90,869,663 L158P probably damaging Het
Exo1 G A 1: 175,892,976 V287M probably damaging Het
Fam171a1 T C 2: 3,225,617 Y471H probably damaging Het
Fermt1 T A 2: 132,942,066 T8S probably benign Het
Fgfr2 G T 7: 130,167,774 P630T probably damaging Het
Fmo5 G A 3: 97,651,622 G466E probably damaging Het
Gm5155 A C 7: 17,902,692 E231D probably benign Het
Hcn4 A G 9: 58,843,932 I280M probably benign Het
Ifi208 A C 1: 173,683,608 K443T probably benign Het
Irs3 A G 5: 137,644,741 F145S probably benign Het
Kirrel T A 3: 87,089,595 H300L probably benign Het
Krit1 A G 5: 3,819,326 Q340R probably damaging Het
Lipo5 T C 19: 33,467,749 D140G unknown Het
Lrrtm4 A T 6: 80,022,700 Q365L probably benign Het
Lrwd1 G T 5: 136,131,150 T353K possibly damaging Het
Lsm14a A T 7: 34,353,729 S240R possibly damaging Het
Map3k5 A G 10: 20,108,238 I870V probably benign Het
Mmp17 A T 5: 129,594,614 E76V probably null Het
Mphosph10 A G 7: 64,388,984 F272L probably damaging Het
Myh10 A G 11: 68,764,245 K380R probably damaging Het
Myo3b C T 2: 70,426,888 P1282L probably damaging Het
Nemp2 T C 1: 52,643,079 probably benign Het
Ola1 T C 2: 73,199,434 I114V probably damaging Het
Olfr1066 T A 2: 86,455,435 T279S probably damaging Het
Olfr140 T A 2: 90,051,913 H137L probably benign Het
Pabpc4 T G 4: 123,290,307 D204E probably benign Het
Pigr A T 1: 130,849,493 M679L probably benign Het
Pik3c2b A T 1: 133,070,408 M341L possibly damaging Het
Ppp2r5e A G 12: 75,515,685 S15P possibly damaging Het
Prdm13 T C 4: 21,678,984 Y502C probably damaging Het
Ptprk T C 10: 28,592,054 probably null Het
Rapgef6 T C 11: 54,657,374 S505P probably benign Het
Rgmb G T 17: 15,820,728 S199* probably null Het
Rgsl1 T C 1: 153,827,492 T173A probably damaging Het
Rhobtb1 G T 10: 69,269,912 K102N probably damaging Het
Ripor2 A T 13: 24,674,666 D147V probably damaging Het
Rsad2 A T 12: 26,450,682 V202E probably damaging Het
Slc1a6 A G 10: 78,793,307 N186S probably damaging Het
Soga1 G A 2: 157,023,817 Q1127* probably null Het
Sorbs3 G A 14: 70,184,896 R622* probably null Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Srgap3 T C 6: 112,766,939 Y446C probably damaging Het
Thsd7b C T 1: 129,678,243 R574* probably null Het
Tmem74 A T 15: 43,866,821 Y275* probably null Het
Topors A T 4: 40,262,541 S248T possibly damaging Het
Trpm1 A T 7: 64,208,946 Y239F probably benign Het
Ttn T A 2: 76,718,183 Y30179F possibly damaging Het
Ugt2b34 A T 5: 86,892,865 F399L probably damaging Het
Ush2a A T 1: 188,356,798 I317F probably damaging Het
Usp1 T C 4: 98,934,618 V723A probably benign Het
Usp34 T G 11: 23,343,616 L237V probably damaging Het
Vgf A T 5: 137,032,286 D434V probably damaging Het
Vmn1r179 A G 7: 23,928,675 N97S probably benign Het
Vps13a A G 19: 16,710,387 L899P possibly damaging Het
Vps33b A T 7: 80,274,253 I41F probably damaging Het
Zap70 A T 1: 36,778,218 H210L probably damaging Het
Zc3h8 T C 2: 128,928,915 D300G probably benign Het
Zfp958 C A 8: 4,626,196 H55N possibly damaging Het
Other mutations in Plin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Plin4 APN 17 56107362 missense probably damaging 0.98
IGL02121:Plin4 APN 17 56102131 missense probably damaging 0.98
IGL02254:Plin4 APN 17 56104733 missense probably damaging 0.98
IGL02539:Plin4 APN 17 56106680 missense probably damaging 1.00
IGL02892:Plin4 APN 17 56105108 missense probably damaging 1.00
IGL03051:Plin4 APN 17 56105417 missense possibly damaging 0.91
IGL03258:Plin4 APN 17 56104371 missense probably benign 0.05
PIT4519001:Plin4 UTSW 17 56103828 missense probably benign 0.23
R0211:Plin4 UTSW 17 56102242 missense probably damaging 1.00
R0365:Plin4 UTSW 17 56104667 missense possibly damaging 0.93
R0545:Plin4 UTSW 17 56106567 missense probably damaging 1.00
R0551:Plin4 UTSW 17 56106756 missense probably benign 0.03
R0862:Plin4 UTSW 17 56103966 missense probably benign 0.00
R0864:Plin4 UTSW 17 56103966 missense probably benign 0.00
R1260:Plin4 UTSW 17 56104348 nonsense probably null
R1650:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1688:Plin4 UTSW 17 56109363 missense possibly damaging 0.61
R1725:Plin4 UTSW 17 56106473 missense probably damaging 1.00
R1803:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1834:Plin4 UTSW 17 56103522 missense probably damaging 0.97
R1953:Plin4 UTSW 17 56103849 missense possibly damaging 0.49
R2860:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2861:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2915:Plin4 UTSW 17 56104389 missense probably damaging 0.98
R3438:Plin4 UTSW 17 56107193 missense probably benign 0.26
R3622:Plin4 UTSW 17 56104112 missense possibly damaging 0.92
R3932:Plin4 UTSW 17 56106704 missense probably benign 0.01
R4116:Plin4 UTSW 17 56102113 missense probably benign 0.30
R4201:Plin4 UTSW 17 56104338 missense probably damaging 1.00
R4529:Plin4 UTSW 17 56104274 missense probably damaging 1.00
R4610:Plin4 UTSW 17 56105418 missense probably benign 0.08
R4692:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4693:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4718:Plin4 UTSW 17 56106981 missense possibly damaging 0.46
R5283:Plin4 UTSW 17 56106777 missense probably benign 0.00
R5333:Plin4 UTSW 17 56104970 missense probably benign 0.31
R5484:Plin4 UTSW 17 56104932 missense possibly damaging 0.90
R5569:Plin4 UTSW 17 56102147 missense probably benign 0.02
R5765:Plin4 UTSW 17 56102470 missense possibly damaging 0.68
R5776:Plin4 UTSW 17 56104983 missense probably damaging 0.99
R5828:Plin4 UTSW 17 56107064 missense probably damaging 0.99
R5932:Plin4 UTSW 17 56106356 missense possibly damaging 0.92
R5988:Plin4 UTSW 17 56109567 missense probably benign 0.03
R6053:Plin4 UTSW 17 56108618 missense probably benign 0.01
R6264:Plin4 UTSW 17 56104787 missense possibly damaging 0.90
R6334:Plin4 UTSW 17 56103261 missense probably benign 0.22
R6415:Plin4 UTSW 17 56103264 missense probably damaging 1.00
R7030:Plin4 UTSW 17 56103969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTTAATGGCTCCTGTGG -3'
(R):5'- GTGGCTAAAGGTACCATCCAGG -3'

Sequencing Primer
(F):5'- TGCCAGTCAGCACAGTCTTG -3'
(R):5'- CTAAAGGTACCATCCAGGGTGGC -3'
Posted On2016-07-22