Incidental Mutation 'R5305:Zfp976'
ID404504
Institutional Source Beutler Lab
Gene Symbol Zfp976
Ensembl Gene ENSMUSG00000074158
Gene Namezinc finger protein 976
Synonyms9830147E19Rik
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42609526-42642588 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42613478 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 312 (Y312N)
Ref Sequence ENSEMBL: ENSMUSP00000141023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098503] [ENSMUST00000187616]
Predicted Effect probably benign
Transcript: ENSMUST00000098503
AA Change: Y313N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096105
Gene: ENSMUSG00000074158
AA Change: Y313N

DomainStartEndE-ValueType
KRAB 4 66 1.73e-18 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 1.67e-2 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 1.38e-3 SMART
ZnF_C2H2 243 265 8.94e-3 SMART
ZnF_C2H2 271 293 2.24e-3 SMART
ZnF_C2H2 299 321 1.03e-2 SMART
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 7.9e-4 SMART
ZnF_C2H2 383 405 5.9e-3 SMART
ZnF_C2H2 411 433 2.57e-3 SMART
ZnF_C2H2 439 461 3.16e-3 SMART
ZnF_C2H2 467 489 1.26e-2 SMART
ZnF_C2H2 495 517 8.34e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 4.79e-3 SMART
ZnF_C2H2 579 601 9.73e-4 SMART
ZnF_C2H2 607 629 3.63e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107994
Predicted Effect probably benign
Transcript: ENSMUST00000187616
AA Change: Y312N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141023
Gene: ENSMUSG00000074158
AA Change: Y312N

DomainStartEndE-ValueType
KRAB 3 65 7.4e-21 SMART
ZnF_C2H2 130 152 3.2e-5 SMART
ZnF_C2H2 158 180 7.1e-5 SMART
ZnF_C2H2 186 208 2.4e-5 SMART
ZnF_C2H2 214 236 5.7e-6 SMART
ZnF_C2H2 242 264 3.8e-5 SMART
ZnF_C2H2 270 292 9.7e-6 SMART
ZnF_C2H2 298 320 4.2e-5 SMART
ZnF_C2H2 326 348 6.6e-6 SMART
ZnF_C2H2 354 376 3.3e-6 SMART
ZnF_C2H2 382 404 2.5e-5 SMART
ZnF_C2H2 410 432 1e-5 SMART
ZnF_C2H2 438 460 1.3e-5 SMART
ZnF_C2H2 466 488 5.2e-5 SMART
ZnF_C2H2 494 516 3.6e-5 SMART
ZnF_C2H2 522 544 1.6e-5 SMART
ZnF_C2H2 550 572 2e-5 SMART
ZnF_C2H2 578 600 4e-6 SMART
ZnF_C2H2 606 628 1.5e-5 SMART
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Zfp976
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Zfp976 APN 7 42613685 missense unknown
IGL01102:Zfp976 APN 7 42613909 nonsense probably null
IGL01111:Zfp976 APN 7 42616287 missense probably damaging 0.99
IGL01628:Zfp976 APN 7 42612511 missense unknown
IGL02008:Zfp976 APN 7 42614232 splice site probably benign
IGL02548:Zfp976 APN 7 42612529 missense unknown
R0190:Zfp976 UTSW 7 42642524 start gained probably benign
R0685:Zfp976 UTSW 7 42613717 missense probably damaging 0.98
R1310:Zfp976 UTSW 7 42613186 missense probably damaging 1.00
R1353:Zfp976 UTSW 7 42616018 missense probably damaging 0.99
R1447:Zfp976 UTSW 7 42612599 missense possibly damaging 0.79
R1569:Zfp976 UTSW 7 42613382 missense probably damaging 1.00
R1702:Zfp976 UTSW 7 42616000 missense possibly damaging 0.86
R1829:Zfp976 UTSW 7 42616311 missense probably damaging 1.00
R1939:Zfp976 UTSW 7 42613681 missense unknown
R1978:Zfp976 UTSW 7 42613841 missense probably damaging 1.00
R1981:Zfp976 UTSW 7 42613622 missense probably damaging 0.99
R2160:Zfp976 UTSW 7 42613930 missense probably benign
R2192:Zfp976 UTSW 7 42613271 missense probably damaging 1.00
R3121:Zfp976 UTSW 7 42613514 missense probably damaging 1.00
R4210:Zfp976 UTSW 7 42616325 missense probably damaging 0.99
R4724:Zfp976 UTSW 7 42613033 missense possibly damaging 0.91
R4943:Zfp976 UTSW 7 42612422 unclassified probably benign
R5047:Zfp976 UTSW 7 42613419 nonsense probably null
R5071:Zfp976 UTSW 7 42612930 nonsense probably null
R5125:Zfp976 UTSW 7 42612501 unclassified probably null
R5178:Zfp976 UTSW 7 42612501 unclassified probably null
R5777:Zfp976 UTSW 7 42614080 missense probably benign 0.00
R6153:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R6694:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R7226:Zfp976 UTSW 7 42613260 nonsense probably null
R7479:Zfp976 UTSW 7 42613179 missense probably benign 0.01
Z1088:Zfp976 UTSW 7 42612760 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CGAAGATAGGTGAGCTGTGC -3'
(R):5'- CTGCTATCTTCGAATTCATGAAAGAAC -3'

Sequencing Primer
(F):5'- AGCTGTGCAAAGGCTTTACC -3'
(R):5'- CATACTGGAGTGAGACCCTACATATG -3'
Posted On2016-07-22