Incidental Mutation 'R5306:Nos1ap'
ID404538
Institutional Source Beutler Lab
Gene Symbol Nos1ap
Ensembl Gene ENSMUSG00000038473
Gene Namenitric oxide synthase 1 (neuronal) adaptor protein
Synonyms6330408P19Rik
MMRRC Submission 042889-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5306 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170302668-170589861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 170349399 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 145 (K145M)
Ref Sequence ENSEMBL: ENSMUSP00000124240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160456] [ENSMUST00000160466] [ENSMUST00000161485] [ENSMUST00000161966]
Predicted Effect probably damaging
Transcript: ENSMUST00000160456
AA Change: K145M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125251
Gene: ENSMUSG00000038473
AA Change: K145M

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 313 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160466
AA Change: K91M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125687
Gene: ENSMUSG00000038473
AA Change: K91M

DomainStartEndE-ValueType
Pfam:PID 1 116 4e-25 PFAM
low complexity region 212 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160816
Predicted Effect probably damaging
Transcript: ENSMUST00000161485
AA Change: K96M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124169
Gene: ENSMUSG00000038473
AA Change: K96M

DomainStartEndE-ValueType
Pfam:PID 1 121 3e-26 PFAM
low complexity region 213 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161966
AA Change: K145M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124240
Gene: ENSMUSG00000038473
AA Change: K145M

DomainStartEndE-ValueType
PTB 27 173 3.59e-42 SMART
low complexity region 266 285 N/A INTRINSIC
low complexity region 290 322 N/A INTRINSIC
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cep104 C A 4: 154,006,242 T884K probably benign Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Exosc10 T C 4: 148,562,392 V153A probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Ifit3 A G 19: 34,587,807 Y251C probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Olfr814 A C 10: 129,873,941 I272R probably damaging Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Plxna4 T C 6: 32,206,121 Y949C probably damaging Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smc5 A G 19: 23,259,645 probably null Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Nos1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Nos1ap APN 1 170514606 splice site probably benign
IGL01151:Nos1ap APN 1 170589276 missense probably damaging 1.00
IGL02056:Nos1ap APN 1 170318623 missense possibly damaging 0.93
IGL02712:Nos1ap APN 1 170329251 missense possibly damaging 0.93
IGL03177:Nos1ap APN 1 170390730 critical splice donor site probably null
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0096:Nos1ap UTSW 1 170329247 missense probably damaging 1.00
R0621:Nos1ap UTSW 1 170318581 missense probably damaging 0.99
R1332:Nos1ap UTSW 1 170349432 missense probably damaging 1.00
R1523:Nos1ap UTSW 1 170338118 missense probably benign 0.03
R1660:Nos1ap UTSW 1 170514637 missense possibly damaging 0.89
R1704:Nos1ap UTSW 1 170338212 missense probably damaging 1.00
R1764:Nos1ap UTSW 1 170318878 missense possibly damaging 0.83
R1905:Nos1ap UTSW 1 170318558 missense possibly damaging 0.70
R2056:Nos1ap UTSW 1 170327646 missense probably damaging 1.00
R2140:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R2141:Nos1ap UTSW 1 170329166 missense probably damaging 0.97
R3890:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3891:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R3892:Nos1ap UTSW 1 170349456 missense probably damaging 1.00
R4109:Nos1ap UTSW 1 170318668 missense probably benign
R5305:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5412:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5414:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5444:Nos1ap UTSW 1 170375251 missense probably damaging 1.00
R5636:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5637:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5638:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5753:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5754:Nos1ap UTSW 1 170349399 missense probably damaging 1.00
R5787:Nos1ap UTSW 1 170318572 missense probably benign 0.41
R7060:Nos1ap UTSW 1 170338125 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGCACACAGTTCAGATGACTC -3'
(R):5'- ATTAGTGAGCTCTGTCTTCTGC -3'

Sequencing Primer
(F):5'- GCACACAGTTCAGATGACTCTAAAG -3'
(R):5'- CCTCCCGTGAGCAGAGGTTTC -3'
Posted On2016-07-22