Incidental Mutation 'R5306:Plxna4'
ID404556
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission 042889-MU
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R5306 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32206121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 949 (Y949C)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: Y949C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: Y949C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cep104 C A 4: 154,006,242 T884K probably benign Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Exosc10 T C 4: 148,562,392 V153A probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Ifit3 A G 19: 34,587,807 Y251C probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Olfr814 A C 10: 129,873,941 I272R probably damaging Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smc5 A G 19: 23,259,645 probably null Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTCTTGCAGCCCTATAAG -3'
(R):5'- CGAAAGCCAGCTTCTGTCTC -3'

Sequencing Primer
(F):5'- TTCTTGCAGCCCTATAAGGAGGC -3'
(R):5'- TGTCTCTGGGCCCTGCTG -3'
Posted On2016-07-22