Incidental Mutation 'R5307:Tnik'
ID404616
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 042890-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5307 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28541972 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 171 (D171E)
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: D171E

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: D171E
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: D171E
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: D171E
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: D171E
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160934
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect probably damaging
Transcript: ENSMUST00000161964
AA Change: D171E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: D171E
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162777
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193721
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGGCCCAGAAAATGTG -3'
(R):5'- AGGTGCCTGTGAGGATCATC -3'

Sequencing Primer
(F):5'- AATGGGCTAGGTCCCTCCATAATC -3'
(R):5'- TGTGAGGATCATCCCCTGAAAAACTG -3'
Posted On2016-07-22