Incidental Mutation 'R5307:Svep1'
ID404621
Institutional Source Beutler Lab
Gene Symbol Svep1
Ensembl Gene ENSMUSG00000028369
Gene Namesushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
SynonymsD430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik
MMRRC Submission 042890-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5307 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58042442-58206859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58072677 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 2211 (N2211D)
Ref Sequence ENSEMBL: ENSMUSP00000045856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042850
AA Change: N2211D

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: N2211D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 51 60 N/A INTRINSIC
VWA 82 261 2.18e-32 SMART
Pfam:GCC2_GCC3 311 361 3.4e-14 PFAM
CCP 379 434 3.62e-8 SMART
CCP 439 494 1.78e-16 SMART
CCP 499 559 2.13e-5 SMART
Pfam:HYR 560 642 1.7e-20 PFAM
Pfam:HYR 643 722 4.6e-15 PFAM
CCP 727 787 3.59e-1 SMART
low complexity region 862 873 N/A INTRINSIC
Pfam:GCC2_GCC3 1004 1051 3.2e-16 PFAM
Pfam:GCC2_GCC3 1058 1105 5.4e-19 PFAM
Pfam:GCC2_GCC3 1112 1159 7.7e-19 PFAM
EGF 1195 1228 3.12e-7 SMART
EGF_CA 1230 1266 3.93e-13 SMART
EGF_CA 1268 1304 8.3e-12 SMART
EGF_CA 1306 1342 4.59e-14 SMART
EGF_CA 1344 1380 8.69e-15 SMART
EGF_CA 1382 1418 3.42e-13 SMART
Pfam:Pentaxin 1429 1622 1.8e-28 PFAM
Pfam:Laminin_G_3 1432 1589 1.1e-20 PFAM
CCP 1630 1684 1.71e-9 SMART
CCP 1689 1742 2.31e-15 SMART
EGF_CA 1744 1783 5.23e-9 SMART
CCP 1788 1841 4.62e-15 SMART
CCP 1846 1899 8.29e-17 SMART
CCP 1904 1957 1.1e-12 SMART
CCP 1962 2015 5.6e-14 SMART
CCP 2020 2077 4.15e-8 SMART
CCP 2082 2140 8.11e-11 SMART
CCP 2145 2198 4.38e-16 SMART
CCP 2203 2258 1.69e-8 SMART
CCP 2263 2317 1.42e-15 SMART
CCP 2322 2375 3.1e-7 SMART
CCP 2380 2434 4.55e-14 SMART
CCP 2439 2492 6.95e-10 SMART
CCP 2497 2550 8.88e-17 SMART
CCP 2555 2607 1.7e-13 SMART
CCP 2651 2709 1.02e-7 SMART
CCP 2714 2767 9.6e-13 SMART
CCP 2772 2825 3.64e-13 SMART
CCP 2830 2883 6.63e-16 SMART
CCP 2888 2941 2.76e-13 SMART
CCP 2946 2999 4.41e-12 SMART
CCP 3004 3055 4.25e-5 SMART
CCP 3060 3113 5.15e-13 SMART
CCP 3118 3172 2.11e-9 SMART
CCP 3177 3232 1.02e-7 SMART
CCP 3237 3290 6.19e-16 SMART
CCP 3295 3348 5.35e-11 SMART
CCP 3353 3407 8.43e-9 SMART
CCP 3412 3464 2.44e-14 SMART
EGF 3467 3496 1.28e-3 SMART
EGF 3499 3528 1.15e-5 SMART
EGF 3531 3560 2.85e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Svep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Svep1 APN 4 58176077 missense probably damaging 0.98
IGL00489:Svep1 APN 4 58068988 missense possibly damaging 0.71
IGL00496:Svep1 APN 4 58069001 missense possibly damaging 0.95
IGL00864:Svep1 APN 4 58068533 nonsense probably null
IGL00904:Svep1 APN 4 58097398 missense probably benign 0.00
IGL00935:Svep1 APN 4 58090664 missense possibly damaging 0.71
IGL00963:Svep1 APN 4 58072791 nonsense probably null
IGL01077:Svep1 APN 4 58068760 missense possibly damaging 0.71
IGL01084:Svep1 APN 4 58111419 missense possibly damaging 0.71
IGL01150:Svep1 APN 4 58070302 missense probably benign 0.04
IGL01161:Svep1 APN 4 58146569 missense probably damaging 0.96
IGL01360:Svep1 APN 4 58116554 missense possibly damaging 0.73
IGL01365:Svep1 APN 4 58100878 critical splice acceptor site probably null
IGL01396:Svep1 APN 4 58068552 missense possibly damaging 0.85
IGL01601:Svep1 APN 4 58084872 missense probably damaging 1.00
IGL01636:Svep1 APN 4 58116622 missense possibly damaging 0.96
IGL01838:Svep1 APN 4 58121910 missense possibly damaging 0.72
IGL01949:Svep1 APN 4 58176006 missense probably damaging 1.00
IGL01984:Svep1 APN 4 58068877 missense possibly damaging 0.93
IGL02005:Svep1 APN 4 58069056 missense possibly damaging 0.93
IGL02036:Svep1 APN 4 58088245 missense possibly damaging 0.85
IGL02039:Svep1 APN 4 58123980 critical splice donor site probably null
IGL02043:Svep1 APN 4 58068556 missense probably benign 0.19
IGL02073:Svep1 APN 4 58070104 missense probably benign 0.06
IGL02188:Svep1 APN 4 58068382 missense possibly damaging 0.71
IGL02256:Svep1 APN 4 58070311 missense possibly damaging 0.71
IGL02284:Svep1 APN 4 58072819 missense probably benign 0.32
IGL02323:Svep1 APN 4 58070236 nonsense probably null
IGL02440:Svep1 APN 4 58145293 missense probably benign 0.06
IGL02449:Svep1 APN 4 58070296 missense possibly damaging 0.71
IGL02501:Svep1 APN 4 58145341 splice site probably benign
IGL02568:Svep1 APN 4 58135441 missense probably benign 0.42
IGL02625:Svep1 APN 4 58115807 missense possibly damaging 0.53
IGL02795:Svep1 APN 4 58123223 missense probably damaging 1.00
IGL02818:Svep1 APN 4 58069804 missense possibly damaging 0.71
IGL02871:Svep1 APN 4 58100871 missense probably benign
IGL02875:Svep1 APN 4 58082821 splice site probably benign
IGL02887:Svep1 APN 4 58145301 missense probably damaging 1.00
IGL03240:Svep1 APN 4 58048188 missense possibly damaging 0.73
IGL03243:Svep1 APN 4 58133387 missense probably benign 0.06
IGL03264:Svep1 APN 4 58066422 splice site probably benign
IGL03288:Svep1 APN 4 58116532 missense probably benign 0.01
IGL03340:Svep1 APN 4 58111451 missense possibly damaging 0.96
IGL03341:Svep1 APN 4 58070308 nonsense probably null
IGL03348:Svep1 APN 4 58113635 missense probably damaging 1.00
R0001:Svep1 UTSW 4 58066460 missense possibly damaging 0.93
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0125:Svep1 UTSW 4 58099937 splice site probably benign
R0142:Svep1 UTSW 4 58118232 missense probably benign 0.33
R0147:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0148:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0157:Svep1 UTSW 4 58069830 missense possibly damaging 0.72
R0195:Svep1 UTSW 4 58089514 missense possibly damaging 0.82
R0197:Svep1 UTSW 4 58070851 missense possibly damaging 0.71
R0257:Svep1 UTSW 4 58179610 missense possibly damaging 0.71
R0314:Svep1 UTSW 4 58096331 missense possibly damaging 0.71
R0316:Svep1 UTSW 4 58072737 missense probably damaging 0.98
R0322:Svep1 UTSW 4 58057996 splice site probably benign
R0426:Svep1 UTSW 4 58073333 missense possibly damaging 0.87
R0446:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R0457:Svep1 UTSW 4 58118136 missense probably damaging 1.00
R0471:Svep1 UTSW 4 58054700 missense possibly damaging 0.85
R0555:Svep1 UTSW 4 58128858 missense possibly damaging 0.71
R0634:Svep1 UTSW 4 58070661 missense possibly damaging 0.86
R0636:Svep1 UTSW 4 58073121 nonsense probably null
R0827:Svep1 UTSW 4 58053113 splice site probably benign
R1025:Svep1 UTSW 4 58087817 missense possibly damaging 0.86
R1027:Svep1 UTSW 4 58094084 missense possibly damaging 0.86
R1069:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1161:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1245:Svep1 UTSW 4 58066427 critical splice donor site probably null
R1282:Svep1 UTSW 4 58100032 missense possibly damaging 0.93
R1310:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1444:Svep1 UTSW 4 58115754 missense possibly damaging 0.53
R1460:Svep1 UTSW 4 58068740 missense possibly damaging 0.85
R1500:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1628:Svep1 UTSW 4 58107561 missense probably benign 0.00
R1712:Svep1 UTSW 4 58070629 missense probably benign 0.06
R1774:Svep1 UTSW 4 58146562 missense possibly damaging 0.92
R1783:Svep1 UTSW 4 58073333 missense probably benign
R1829:Svep1 UTSW 4 58096310 missense possibly damaging 0.93
R1978:Svep1 UTSW 4 58097292 missense possibly damaging 0.73
R1993:Svep1 UTSW 4 58064170 critical splice donor site probably null
R2017:Svep1 UTSW 4 58070568 missense probably benign 0.08
R2058:Svep1 UTSW 4 58084554 missense possibly damaging 0.92
R2109:Svep1 UTSW 4 58206030 missense possibly damaging 0.51
R2215:Svep1 UTSW 4 58138602 splice site probably benign
R2281:Svep1 UTSW 4 58082677 missense possibly damaging 0.85
R2504:Svep1 UTSW 4 58135628 splice site probably null
R2763:Svep1 UTSW 4 58084061 missense possibly damaging 0.86
R3122:Svep1 UTSW 4 58087845 missense possibly damaging 0.51
R3605:Svep1 UTSW 4 58066542 missense probably benign 0.32
R3763:Svep1 UTSW 4 58084833 missense possibly damaging 0.89
R3827:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3829:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3830:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3910:Svep1 UTSW 4 58145156 critical splice donor site probably null
R3943:Svep1 UTSW 4 58084807 splice site probably null
R3944:Svep1 UTSW 4 58084807 splice site probably null
R4153:Svep1 UTSW 4 58089426 missense possibly damaging 0.52
R4154:Svep1 UTSW 4 58069068 missense possibly damaging 0.71
R4191:Svep1 UTSW 4 58046601 missense possibly damaging 0.86
R4355:Svep1 UTSW 4 58138695 missense possibly damaging 0.71
R4388:Svep1 UTSW 4 58069249 missense possibly damaging 0.93
R4532:Svep1 UTSW 4 58068886 missense possibly damaging 0.52
R4584:Svep1 UTSW 4 58068526 nonsense probably null
R4592:Svep1 UTSW 4 58084028 missense possibly damaging 0.93
R4593:Svep1 UTSW 4 58091944 missense possibly damaging 0.71
R4625:Svep1 UTSW 4 58072698 missense probably damaging 0.98
R4639:Svep1 UTSW 4 58082724 missense probably benign
R4700:Svep1 UTSW 4 58097323 missense possibly damaging 0.71
R4720:Svep1 UTSW 4 58205869 missense possibly damaging 0.71
R4724:Svep1 UTSW 4 58070752 missense possibly damaging 0.71
R4753:Svep1 UTSW 4 58053212 missense probably benign 0.06
R4781:Svep1 UTSW 4 58070340 missense probably damaging 0.98
R4820:Svep1 UTSW 4 58082664 missense probably benign 0.27
R4896:Svep1 UTSW 4 58087751 missense probably benign 0.08
R4905:Svep1 UTSW 4 58069308 missense probably benign 0.00
R4910:Svep1 UTSW 4 58096276 missense possibly damaging 0.71
R4972:Svep1 UTSW 4 58087778 missense possibly damaging 0.71
R5004:Svep1 UTSW 4 58087751 missense probably benign 0.08
R5088:Svep1 UTSW 4 58120648 missense possibly damaging 0.73
R5112:Svep1 UTSW 4 58068610 nonsense probably null
R5185:Svep1 UTSW 4 58084534 missense probably damaging 0.99
R5302:Svep1 UTSW 4 58096183 missense possibly damaging 0.71
R5339:Svep1 UTSW 4 58121892 missense possibly damaging 0.96
R5379:Svep1 UTSW 4 58072991 missense possibly damaging 0.51
R5384:Svep1 UTSW 4 58104545 missense possibly damaging 0.71
R5414:Svep1 UTSW 4 58206322 missense possibly damaging 0.53
R5514:Svep1 UTSW 4 58044054 missense possibly damaging 0.53
R5538:Svep1 UTSW 4 58049282 critical splice acceptor site probably null
R5549:Svep1 UTSW 4 58057954 missense probably benign 0.32
R5618:Svep1 UTSW 4 58070537 missense probably benign
R5623:Svep1 UTSW 4 58091964 missense possibly damaging 0.92
R5686:Svep1 UTSW 4 58072826 missense possibly damaging 0.71
R5743:Svep1 UTSW 4 58096223 missense possibly damaging 0.71
R5773:Svep1 UTSW 4 58099985 missense possibly damaging 0.86
R5809:Svep1 UTSW 4 58116524 missense possibly damaging 0.73
R5896:Svep1 UTSW 4 58084906 missense possibly damaging 0.71
R5918:Svep1 UTSW 4 58069345 missense possibly damaging 0.71
R5969:Svep1 UTSW 4 58070977 nonsense probably null
R6010:Svep1 UTSW 4 58115832 missense possibly damaging 0.95
R6187:Svep1 UTSW 4 58072872 missense probably damaging 1.00
R6192:Svep1 UTSW 4 58104536 missense possibly damaging 0.92
R6209:Svep1 UTSW 4 58128869 missense probably benign 0.32
R6234:Svep1 UTSW 4 58113458 intron probably null
R6326:Svep1 UTSW 4 58073045 missense possibly damaging 0.51
R6400:Svep1 UTSW 4 58049169 missense probably damaging 1.00
R6418:Svep1 UTSW 4 58053126 missense probably benign 0.01
R6440:Svep1 UTSW 4 58116555 missense possibly damaging 0.53
R6489:Svep1 UTSW 4 58100066 missense probably damaging 1.00
R6515:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R6738:Svep1 UTSW 4 58123180 missense possibly damaging 0.71
R6773:Svep1 UTSW 4 58049146 missense possibly damaging 0.71
R6796:Svep1 UTSW 4 58064275 missense probably benign 0.01
R7055:Svep1 UTSW 4 58064275 missense probably benign 0.19
R7055:Svep1 UTSW 4 58120642 missense probably benign 0.33
R7111:Svep1 UTSW 4 58118207 missense possibly damaging 0.70
R7161:Svep1 UTSW 4 58128859 missense possibly damaging 0.93
R7162:Svep1 UTSW 4 58070262 missense possibly damaging 0.71
R7182:Svep1 UTSW 4 58043991 missense probably benign 0.18
R7292:Svep1 UTSW 4 58111395 missense possibly damaging 0.71
R7299:Svep1 UTSW 4 58046587 nonsense probably null
R7301:Svep1 UTSW 4 58046587 nonsense probably null
R7316:Svep1 UTSW 4 58068763 missense possibly damaging 0.71
R7337:Svep1 UTSW 4 58108323 missense probably damaging 0.98
R7391:Svep1 UTSW 4 58145185 missense probably damaging 0.98
R7402:Svep1 UTSW 4 58069699 missense possibly damaging 0.71
R7445:Svep1 UTSW 4 58094122 missense possibly damaging 0.85
R7450:Svep1 UTSW 4 58064248 missense possibly damaging 0.71
X0063:Svep1 UTSW 4 58070468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTACTATAATGCAGAAAGATGC -3'
(R):5'- ATCGCAAATGGCTACCCGAG -3'

Sequencing Primer
(F):5'- TGGCTATATGTGCAGGCCAATACC -3'
(R):5'- CCGAGTGGGACAAACTACAGTTTTG -3'
Posted On2016-07-22