Incidental Mutation 'R5307:Chd9'
ID 404644
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Name chromodomain helicase DNA binding protein 9
Synonyms AD013, 1810014J18Rik, 9030205D12Rik, A330063D19Rik
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 91554980-91781144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 91723777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 617 (A617T)
Ref Sequence ENSEMBL: ENSMUSP00000147741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: A1090T
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: A1090T

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: A1090T
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: A1090T

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209203
AA Change: A1090T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: A1090T
Predicted Effect probably damaging
Transcript: ENSMUST00000210947
AA Change: A617T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211552
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91,752,020 (GRCm39) missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91,732,426 (GRCm39) missense probably damaging 1.00
IGL00589:Chd9 APN 8 91,742,474 (GRCm39) missense probably damaging 1.00
IGL00640:Chd9 APN 8 91,712,760 (GRCm39) missense probably damaging 0.99
IGL00663:Chd9 APN 8 91,710,118 (GRCm39) missense probably damaging 1.00
IGL00852:Chd9 APN 8 91,699,835 (GRCm39) missense probably benign 0.29
IGL00908:Chd9 APN 8 91,723,508 (GRCm39) missense probably damaging 1.00
IGL00911:Chd9 APN 8 91,778,320 (GRCm39) missense probably damaging 1.00
IGL01068:Chd9 APN 8 91,768,744 (GRCm39) missense probably benign 0.13
IGL01668:Chd9 APN 8 91,753,404 (GRCm39) missense possibly damaging 0.53
IGL01873:Chd9 APN 8 91,660,395 (GRCm39) missense probably benign 0.00
IGL01969:Chd9 APN 8 91,760,138 (GRCm39) missense possibly damaging 0.72
IGL02105:Chd9 APN 8 91,659,116 (GRCm39) missense probably damaging 1.00
IGL02153:Chd9 APN 8 91,683,122 (GRCm39) nonsense probably null
IGL02164:Chd9 APN 8 91,659,849 (GRCm39) missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91,778,312 (GRCm39) missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91,760,210 (GRCm39) missense probably benign 0.33
IGL02892:Chd9 APN 8 91,703,543 (GRCm39) splice site probably benign
IGL02897:Chd9 APN 8 91,660,496 (GRCm39) splice site probably benign
IGL03005:Chd9 APN 8 91,738,075 (GRCm39) missense probably damaging 0.98
IGL03062:Chd9 APN 8 91,741,895 (GRCm39) splice site probably benign
IGL03140:Chd9 APN 8 91,768,856 (GRCm39) missense possibly damaging 0.91
hovel UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
shack UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R0056:Chd9 UTSW 8 91,660,165 (GRCm39) missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91,735,464 (GRCm39) splice site probably null
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0432:Chd9 UTSW 8 91,721,078 (GRCm39) splice site probably benign
R0454:Chd9 UTSW 8 91,699,859 (GRCm39) missense possibly damaging 0.83
R0573:Chd9 UTSW 8 91,725,223 (GRCm39) missense probably damaging 1.00
R0580:Chd9 UTSW 8 91,721,191 (GRCm39) missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91,763,170 (GRCm39) missense possibly damaging 0.82
R0662:Chd9 UTSW 8 91,704,304 (GRCm39) missense probably damaging 0.99
R0825:Chd9 UTSW 8 91,777,825 (GRCm39) missense probably benign 0.06
R0945:Chd9 UTSW 8 91,659,630 (GRCm39) missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
R0967:Chd9 UTSW 8 91,716,107 (GRCm39) missense probably damaging 1.00
R1015:Chd9 UTSW 8 91,659,206 (GRCm39) missense probably damaging 0.99
R1066:Chd9 UTSW 8 91,712,764 (GRCm39) nonsense probably null
R1244:Chd9 UTSW 8 91,749,557 (GRCm39) missense probably damaging 0.99
R1505:Chd9 UTSW 8 91,733,123 (GRCm39) splice site probably null
R1570:Chd9 UTSW 8 91,763,170 (GRCm39) missense probably benign 0.03
R1591:Chd9 UTSW 8 91,710,166 (GRCm39) missense probably damaging 0.97
R1624:Chd9 UTSW 8 91,725,163 (GRCm39) missense probably benign 0.17
R1626:Chd9 UTSW 8 91,721,224 (GRCm39) missense probably benign 0.00
R1632:Chd9 UTSW 8 91,683,335 (GRCm39) nonsense probably null
R1649:Chd9 UTSW 8 91,659,229 (GRCm39) missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91,749,418 (GRCm39) splice site probably null
R1668:Chd9 UTSW 8 91,767,814 (GRCm39) missense probably damaging 0.99
R1681:Chd9 UTSW 8 91,699,763 (GRCm39) missense probably damaging 0.98
R1695:Chd9 UTSW 8 91,728,410 (GRCm39) missense probably damaging 1.00
R1714:Chd9 UTSW 8 91,760,853 (GRCm39) utr 3 prime probably benign
R1746:Chd9 UTSW 8 91,737,326 (GRCm39) missense probably benign 0.01
R1843:Chd9 UTSW 8 91,737,422 (GRCm39) missense probably benign 0.19
R1844:Chd9 UTSW 8 91,683,323 (GRCm39) nonsense probably null
R1941:Chd9 UTSW 8 91,703,697 (GRCm39) critical splice donor site probably null
R2022:Chd9 UTSW 8 91,761,682 (GRCm39) missense probably benign 0.17
R2027:Chd9 UTSW 8 91,634,619 (GRCm39) unclassified probably benign
R2098:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2099:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2100:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2101:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2224:Chd9 UTSW 8 91,737,913 (GRCm39) missense probably benign 0.04
R2276:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2278:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2316:Chd9 UTSW 8 91,777,756 (GRCm39) missense probably damaging 0.99
R2507:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2508:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2988:Chd9 UTSW 8 91,757,088 (GRCm39) splice site probably null
R3418:Chd9 UTSW 8 91,763,219 (GRCm39) missense probably damaging 1.00
R3817:Chd9 UTSW 8 91,710,893 (GRCm39) splice site probably benign
R3923:Chd9 UTSW 8 91,660,147 (GRCm39) missense probably benign 0.16
R4001:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4003:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4006:Chd9 UTSW 8 91,660,188 (GRCm39) missense probably benign 0.12
R4013:Chd9 UTSW 8 91,699,797 (GRCm39) missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91,750,202 (GRCm39) missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91,737,304 (GRCm39) missense probably benign 0.04
R4125:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4126:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4452:Chd9 UTSW 8 91,704,308 (GRCm39) missense probably damaging 0.99
R4463:Chd9 UTSW 8 91,705,627 (GRCm39) missense probably benign 0.01
R4478:Chd9 UTSW 8 91,760,659 (GRCm39) utr 3 prime probably benign
R4587:Chd9 UTSW 8 91,763,134 (GRCm39) missense possibly damaging 0.95
R4628:Chd9 UTSW 8 91,710,091 (GRCm39) missense probably benign 0.05
R4667:Chd9 UTSW 8 91,760,428 (GRCm39) missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91,741,877 (GRCm39) missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91,760,858 (GRCm39) missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91,760,336 (GRCm39) missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91,733,254 (GRCm39) nonsense probably null
R5083:Chd9 UTSW 8 91,711,002 (GRCm39) missense probably damaging 1.00
R5088:Chd9 UTSW 8 91,704,147 (GRCm39) missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91,753,462 (GRCm39) nonsense probably null
R5541:Chd9 UTSW 8 91,778,132 (GRCm39) missense probably benign 0.09
R5559:Chd9 UTSW 8 91,742,553 (GRCm39) critical splice donor site probably null
R5638:Chd9 UTSW 8 91,738,078 (GRCm39) missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91,763,190 (GRCm39) missense probably damaging 1.00
R5793:Chd9 UTSW 8 91,728,384 (GRCm39) missense probably damaging 1.00
R5827:Chd9 UTSW 8 91,716,078 (GRCm39) missense probably damaging 1.00
R5834:Chd9 UTSW 8 91,723,792 (GRCm39) missense probably damaging 1.00
R5875:Chd9 UTSW 8 91,778,464 (GRCm39) missense probably damaging 0.99
R6002:Chd9 UTSW 8 91,705,515 (GRCm39) missense probably damaging 1.00
R6091:Chd9 UTSW 8 91,761,691 (GRCm39) missense probably damaging 1.00
R6185:Chd9 UTSW 8 91,775,765 (GRCm39) missense probably damaging 1.00
R6246:Chd9 UTSW 8 91,659,045 (GRCm39) missense probably damaging 1.00
R6292:Chd9 UTSW 8 91,659,550 (GRCm39) missense probably benign 0.05
R6305:Chd9 UTSW 8 91,757,174 (GRCm39) missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91,737,903 (GRCm39) missense possibly damaging 0.95
R6438:Chd9 UTSW 8 91,725,149 (GRCm39) missense probably benign 0.02
R6470:Chd9 UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R6798:Chd9 UTSW 8 91,778,182 (GRCm39) missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91,769,579 (GRCm39) missense probably damaging 1.00
R6908:Chd9 UTSW 8 91,683,044 (GRCm39) missense probably benign 0.02
R6929:Chd9 UTSW 8 91,769,573 (GRCm39) missense probably damaging 1.00
R6969:Chd9 UTSW 8 91,705,542 (GRCm39) missense probably benign 0.34
R7043:Chd9 UTSW 8 91,760,843 (GRCm39) utr 3 prime probably benign
R7094:Chd9 UTSW 8 91,716,189 (GRCm39) missense unknown
R7126:Chd9 UTSW 8 91,741,853 (GRCm39) missense unknown
R7182:Chd9 UTSW 8 91,733,250 (GRCm39) missense unknown
R7219:Chd9 UTSW 8 91,728,394 (GRCm39) missense unknown
R7260:Chd9 UTSW 8 91,721,171 (GRCm39) missense unknown
R7293:Chd9 UTSW 8 91,760,707 (GRCm39) missense unknown
R7303:Chd9 UTSW 8 91,778,532 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,760,846 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,710,115 (GRCm39) missense unknown
R7451:Chd9 UTSW 8 91,760,446 (GRCm39) missense probably benign 0.27
R7451:Chd9 UTSW 8 91,760,418 (GRCm39) frame shift probably null
R7456:Chd9 UTSW 8 91,659,153 (GRCm39) nonsense probably null
R7481:Chd9 UTSW 8 91,683,066 (GRCm39) missense unknown
R7532:Chd9 UTSW 8 91,721,193 (GRCm39) missense unknown
R7570:Chd9 UTSW 8 91,721,208 (GRCm39) missense unknown
R7611:Chd9 UTSW 8 91,763,017 (GRCm39) missense probably damaging 1.00
R7673:Chd9 UTSW 8 91,778,325 (GRCm39) missense probably damaging 0.96
R7723:Chd9 UTSW 8 91,741,837 (GRCm39) missense unknown
R7739:Chd9 UTSW 8 91,761,653 (GRCm39) missense probably damaging 1.00
R7759:Chd9 UTSW 8 91,704,178 (GRCm39) critical splice donor site probably null
R7916:Chd9 UTSW 8 91,761,684 (GRCm39) nonsense probably null
R7921:Chd9 UTSW 8 91,768,909 (GRCm39) critical splice donor site probably null
R7957:Chd9 UTSW 8 91,778,326 (GRCm39) missense probably damaging 0.99
R7972:Chd9 UTSW 8 91,732,395 (GRCm39) missense unknown
R8108:Chd9 UTSW 8 91,659,852 (GRCm39) missense unknown
R8115:Chd9 UTSW 8 91,762,960 (GRCm39) missense probably damaging 0.99
R8165:Chd9 UTSW 8 91,767,769 (GRCm39) missense probably damaging 1.00
R8171:Chd9 UTSW 8 91,752,015 (GRCm39) missense possibly damaging 0.92
R8186:Chd9 UTSW 8 91,725,233 (GRCm39) missense unknown
R8208:Chd9 UTSW 8 91,763,891 (GRCm39) splice site probably null
R8256:Chd9 UTSW 8 91,660,129 (GRCm39) missense unknown
R8281:Chd9 UTSW 8 91,763,225 (GRCm39) missense probably damaging 1.00
R8504:Chd9 UTSW 8 91,723,472 (GRCm39) missense unknown
R8836:Chd9 UTSW 8 91,767,812 (GRCm39) missense probably damaging 0.99
R8892:Chd9 UTSW 8 91,660,468 (GRCm39) missense unknown
R8985:Chd9 UTSW 8 91,721,101 (GRCm39) missense unknown
R9029:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9030:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9038:Chd9 UTSW 8 91,716,233 (GRCm39) missense unknown
R9081:Chd9 UTSW 8 91,704,144 (GRCm39) nonsense probably null
R9134:Chd9 UTSW 8 91,659,754 (GRCm39) missense unknown
R9205:Chd9 UTSW 8 91,757,270 (GRCm39) missense probably benign 0.01
R9309:Chd9 UTSW 8 91,733,319 (GRCm39) missense unknown
R9375:Chd9 UTSW 8 91,725,335 (GRCm39) critical splice donor site probably null
R9449:Chd9 UTSW 8 91,659,174 (GRCm39) missense unknown
R9547:Chd9 UTSW 8 91,683,186 (GRCm39) missense unknown
R9573:Chd9 UTSW 8 91,704,302 (GRCm39) missense unknown
R9576:Chd9 UTSW 8 91,659,294 (GRCm39) missense unknown
R9601:Chd9 UTSW 8 91,732,360 (GRCm39) nonsense probably null
R9613:Chd9 UTSW 8 91,683,150 (GRCm39) nonsense probably null
R9639:Chd9 UTSW 8 91,760,840 (GRCm39) missense probably null
R9718:Chd9 UTSW 8 91,712,801 (GRCm39) missense unknown
R9746:Chd9 UTSW 8 91,738,063 (GRCm39) missense unknown
R9762:Chd9 UTSW 8 91,712,741 (GRCm39) missense unknown
R9764:Chd9 UTSW 8 91,721,220 (GRCm39) missense unknown
R9790:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
R9791:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
RF007:Chd9 UTSW 8 91,760,578 (GRCm39) missense possibly damaging 0.66
X0065:Chd9 UTSW 8 91,763,200 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTGTTCAGCCTTCTTCAC -3'
(R):5'- TACGGATGATTGCAGCATTTCC -3'

Sequencing Primer
(F):5'- CATTCATGCAAGAGTTTGGAGACCTG -3'
(R):5'- ATGATTGCAGCATTTCCTGAGC -3'
Posted On 2016-07-22