Incidental Mutation 'R5307:2410089E03Rik'
List |< first << previous [record 93 of 19097] next >> last >|
ID404671
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
MMRRC Submission 042890-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5307 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 8260690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect probably null
Transcript: ENSMUST00000110617
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Meta Mutation Damage Score 0.6144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGGATTCAGCGTCCTCC -3'
(R):5'- CAACAGAGCCTTAATTTACTTAGCCTG -3'

Sequencing Primer
(F):5'- GGATTCAGCGTCCTCCTGACC -3'
(R):5'- GCCTTAATTTACTTAGCCTGACAGAG -3'
Posted On2016-07-22