Incidental Mutation 'R5307:Ehhadh'
ID404675
Institutional Source Beutler Lab
Gene Symbol Ehhadh
Ensembl Gene ENSMUSG00000022853
Gene Nameenoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
SynonymsMFP, L-PBE, MFP1, L-bifunctional enzyme, 1300002P22Rik, HD
MMRRC Submission 042890-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5307 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location21761287-21787807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21762692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 517 (S517A)
Ref Sequence ENSEMBL: ENSMUSP00000023559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023559]
Predicted Effect probably benign
Transcript: ENSMUST00000023559
AA Change: S517A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023559
Gene: ENSMUSG00000022853
AA Change: S517A

DomainStartEndE-ValueType
Pfam:ECH_1 6 203 2.4e-41 PFAM
Pfam:ECH_2 11 254 3.2e-26 PFAM
Pfam:3HCDH_N 297 471 1e-55 PFAM
Pfam:3HCDH 473 577 2.7e-29 PFAM
Pfam:3HCDH 614 710 5.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme and is one of the four enzymes of the peroxisomal beta-oxidation pathway. The N-terminal region of the encoded protein contains enoyl-CoA hydratase activity while the C-terminal region contains 3-hydroxyacyl-CoA dehydrogenase activity. Defects in this gene are a cause of peroxisomal disorders such as Zellweger syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Ehhadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Ehhadh APN 16 21762629 missense possibly damaging 0.46
IGL02351:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02358:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02946:Ehhadh APN 16 21762922 missense probably damaging 1.00
IGL03028:Ehhadh APN 16 21762394 missense probably damaging 1.00
IGL03274:Ehhadh APN 16 21763340 splice site probably benign
IGL03097:Ehhadh UTSW 16 21762770 missense probably benign
R0201:Ehhadh UTSW 16 21773493 critical splice donor site probably null
R0846:Ehhadh UTSW 16 21773497 nonsense probably null
R1194:Ehhadh UTSW 16 21762091 missense probably benign 0.10
R1601:Ehhadh UTSW 16 21766408 missense probably benign
R1739:Ehhadh UTSW 16 21762253 missense probably benign
R1829:Ehhadh UTSW 16 21762178 missense probably damaging 0.99
R4073:Ehhadh UTSW 16 21766507 missense probably benign 0.00
R4120:Ehhadh UTSW 16 21763184 missense probably benign
R4239:Ehhadh UTSW 16 21762688 missense probably damaging 1.00
R4303:Ehhadh UTSW 16 21762852 missense probably damaging 1.00
R4727:Ehhadh UTSW 16 21762431 missense probably benign 0.11
R4838:Ehhadh UTSW 16 21763202 missense possibly damaging 0.45
R5157:Ehhadh UTSW 16 21766511 missense probably benign 0.00
R5284:Ehhadh UTSW 16 21763344 splice site probably null
R5346:Ehhadh UTSW 16 21762790 missense probably damaging 1.00
R5872:Ehhadh UTSW 16 21766555 missense probably benign 0.01
R6762:Ehhadh UTSW 16 21762459 missense probably benign 0.01
R6960:Ehhadh UTSW 16 21762278 missense probably benign
R7153:Ehhadh UTSW 16 21766321 missense probably damaging 1.00
X0018:Ehhadh UTSW 16 21762448 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GACCCAGTGGCTTGTCATAC -3'
(R):5'- CTACCATCGCCACAGTCATG -3'

Sequencing Primer
(F):5'- CAGTGGCTTGTCATACTGATACCAG -3'
(R):5'- CAGTCATGAGCTTATCCAAAAGG -3'
Posted On2016-07-22