Incidental Mutation 'R5309:Ccdc173'
ID404689
Institutional Source Beutler Lab
Gene Symbol Ccdc173
Ensembl Gene ENSMUSG00000070883
Gene Namecoiled-coil domain containing 173
Synonyms4930525K21Rik, 4930578N16Rik
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69758033-69789575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69787258 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 60 (T60A)
Ref Sequence ENSEMBL: ENSMUSP00000092548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028494] [ENSMUST00000094942] [ENSMUST00000112266] [ENSMUST00000151298] [ENSMUST00000180290]
Predicted Effect probably benign
Transcript: ENSMUST00000028494
SMART Domains Protein: ENSMUSP00000028494
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 1.2e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094942
AA Change: T60A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092548
Gene: ENSMUSG00000070883
AA Change: T60A

DomainStartEndE-ValueType
coiled coil region 47 131 N/A INTRINSIC
Pfam:TPH 142 475 8.9e-22 PFAM
low complexity region 494 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112266
SMART Domains Protein: ENSMUSP00000107885
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 9.3e-99 PFAM
Pfam:HAD_2 5 128 8.9e-7 PFAM
Pfam:HAD 5 187 3.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131100
Predicted Effect probably benign
Transcript: ENSMUST00000151298
SMART Domains Protein: ENSMUSP00000118021
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 51 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180290
SMART Domains Protein: ENSMUSP00000136471
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 9.3e-99 PFAM
Pfam:HAD_2 5 128 8.9e-7 PFAM
Pfam:HAD 5 187 3.2e-15 PFAM
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Ccdc173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ccdc173 APN 2 69771984 missense probably benign
IGL01768:Ccdc173 APN 2 69782127 splice site probably benign
IGL01801:Ccdc173 APN 2 69776279 splice site probably benign
R0553:Ccdc173 UTSW 2 69789441 missense probably damaging 1.00
R1226:Ccdc173 UTSW 2 69787209 missense possibly damaging 0.63
R1867:Ccdc173 UTSW 2 69781837 splice site probably null
R4821:Ccdc173 UTSW 2 69782108 missense possibly damaging 0.76
R5312:Ccdc173 UTSW 2 69787258 missense possibly damaging 0.92
R5916:Ccdc173 UTSW 2 69789462 start codon destroyed probably null 0.95
R6072:Ccdc173 UTSW 2 69772058 missense probably benign 0.31
R6232:Ccdc173 UTSW 2 69772054 missense possibly damaging 0.64
R6236:Ccdc173 UTSW 2 69758041 utr 3 prime probably null
R6909:Ccdc173 UTSW 2 69781848 intron probably null
R7497:Ccdc173 UTSW 2 69758448 missense probably benign 0.04
R7502:Ccdc173 UTSW 2 69776144 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTATAAGGCACTACTCAGAAG -3'
(R):5'- TCCCTCAGCCAATCTTAAGTTACAC -3'

Sequencing Primer
(F):5'- GCACTACTCAGAAGCAGCAGTTATTG -3'
(R):5'- AAGTCAGGTGAACTCTTCCTG -3'
Posted On2016-07-22