Incidental Mutation 'R5309:Sema4a'
ID404697
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
SynonymsSemB, Semab, SemB
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88435959-88461182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88437036 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 636 (S636F)
Ref Sequence ENSEMBL: ENSMUSP00000128887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222]
Predicted Effect probably damaging
Transcript: ENSMUST00000029700
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: S636F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107531
AA Change: S504F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064
AA Change: S504F

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156108
Predicted Effect probably damaging
Transcript: ENSMUST00000165898
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: S636F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166237
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: S636F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169222
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: S636F

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183768
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88449810 missense probably damaging 1.00
IGL01722:Sema4a APN 3 88438184 missense probably benign 0.14
IGL01769:Sema4a APN 3 88449756 missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88450522 missense probably damaging 0.99
IGL02202:Sema4a APN 3 88449743 missense probably damaging 1.00
R0145:Sema4a UTSW 3 88451422 missense probably damaging 1.00
R0386:Sema4a UTSW 3 88436800 missense possibly damaging 0.75
R0837:Sema4a UTSW 3 88453098 missense possibly damaging 0.46
R0863:Sema4a UTSW 3 88448149 unclassified probably benign
R1567:Sema4a UTSW 3 88452046 missense probably damaging 1.00
R1675:Sema4a UTSW 3 88454766 missense possibly damaging 0.66
R1739:Sema4a UTSW 3 88436838 missense possibly damaging 0.94
R1801:Sema4a UTSW 3 88436749 missense probably benign 0.04
R1961:Sema4a UTSW 3 88438176 splice site probably benign
R2029:Sema4a UTSW 3 88451361 missense probably damaging 1.00
R4934:Sema4a UTSW 3 88438261 missense probably damaging 1.00
R5006:Sema4a UTSW 3 88436784 missense probably benign
R5312:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5338:Sema4a UTSW 3 88451497 missense probably benign 0.01
R5481:Sema4a UTSW 3 88453040 nonsense probably null
R5510:Sema4a UTSW 3 88449986 critical splice donor site probably null
R6046:Sema4a UTSW 3 88440701 missense probably damaging 1.00
R7242:Sema4a UTSW 3 88450109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGGAGCCTTTTCCCTG -3'
(R):5'- TAAAGAAGTCCTGACAGTCCCC -3'

Sequencing Primer
(F):5'- ACTCCCAGGAGCACGATG -3'
(R):5'- TCCATCCTGGAGCTGCC -3'
Posted On2016-07-22