Incidental Mutation 'R5309:Fancg'
ID404700
Institutional Source Beutler Lab
Gene Symbol Fancg
Ensembl Gene ENSMUSG00000028453
Gene NameFanconi anemia, complementation group G
SynonymsXrcc9
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43002343-43010506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43003019 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 613 (F613L)
Ref Sequence ENSEMBL: ENSMUSP00000030165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164] [ENSMUST00000030165]
Predicted Effect probably benign
Transcript: ENSMUST00000030164
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030165
AA Change: F613L

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030165
Gene: ENSMUSG00000028453
AA Change: F613L

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Pfam:TPR_1 251 280 4.1e-6 PFAM
Pfam:TPR_2 251 281 7.3e-5 PFAM
Pfam:TPR_8 251 281 4.5e-3 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Blast:TPR 458 491 4e-9 BLAST
Blast:TPR 518 550 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148182
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females and males homozygous for targeted null mutations exhibit hypogonadism and reduced fertility. Cytogeneic analysis showed somatic chromosome aberrations occur at a higher spontaneous rate and are easier to induce than in normal cells. Cells are also more sensitive to mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Fancg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Fancg APN 4 43003910 nonsense probably null
IGL02072:Fancg APN 4 43007062 missense probably benign 0.00
IGL02184:Fancg APN 4 43006872 missense possibly damaging 0.79
IGL02989:Fancg APN 4 43007121 splice site probably benign
R0671:Fancg UTSW 4 43002998 missense probably benign 0.00
R1581:Fancg UTSW 4 43007039 missense probably damaging 1.00
R1853:Fancg UTSW 4 43009727 missense probably benign 0.00
R2046:Fancg UTSW 4 43004604 missense probably damaging 1.00
R2519:Fancg UTSW 4 43008787 missense probably damaging 1.00
R4282:Fancg UTSW 4 43003830 missense probably damaging 1.00
R4397:Fancg UTSW 4 43008897 missense probably benign 0.02
R4583:Fancg UTSW 4 43002991 missense probably benign
R4671:Fancg UTSW 4 43005272 missense probably benign 0.01
R4887:Fancg UTSW 4 43006866 missense probably benign 0.18
R5312:Fancg UTSW 4 43003019 missense probably benign 0.23
R5325:Fancg UTSW 4 43006564 missense probably damaging 0.99
R5379:Fancg UTSW 4 43002998 missense probably benign 0.00
R5386:Fancg UTSW 4 43007076 nonsense probably null
R5649:Fancg UTSW 4 43008736 missense probably damaging 1.00
R5788:Fancg UTSW 4 43007130 intron probably benign
R5802:Fancg UTSW 4 43006582 missense probably benign
R6217:Fancg UTSW 4 43010084 missense probably benign 0.03
R6698:Fancg UTSW 4 43007034 missense probably benign 0.00
R7092:Fancg UTSW 4 43004831 missense probably benign 0.03
R7527:Fancg UTSW 4 43010116
Predicted Primers PCR Primer
(F):5'- CACTCTGGAACTAGACTGGTAG -3'
(R):5'- CTGTGCTTCTGAGACCTAGC -3'

Sequencing Primer
(F):5'- CTGGTAGCAAGTAGATCAAGGTTCAC -3'
(R):5'- CAGGTCTCTTCCACTGTAT -3'
Posted On2016-07-22