Incidental Mutation 'R5309:Klc1'
ID404737
Institutional Source Beutler Lab
Gene Symbol Klc1
Ensembl Gene ENSMUSG00000021288
Gene Namekinesin light chain 1
SynonymsKns2
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111758849-111807844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111795621 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 575 (K575R)
Ref Sequence ENSEMBL: ENSMUSP00000082004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084941] [ENSMUST00000118471] [ENSMUST00000120544] [ENSMUST00000122300] [ENSMUST00000134578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084941
AA Change: K575R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288
AA Change: K575R

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.1e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118471
SMART Domains Protein: ENSMUSP00000113171
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 8.3e-69 PFAM
Pfam:TPR_10 212 253 7.2e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120544
SMART Domains Protein: ENSMUSP00000113237
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.2e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122300
AA Change: K567R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288
AA Change: K567R

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 1e-68 PFAM
Pfam:TPR_10 212 253 8.4e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 2.99e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124197
Predicted Effect probably benign
Transcript: ENSMUST00000134578
SMART Domains Protein: ENSMUSP00000120491
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:TPR_1 1 25 1.9e-4 PFAM
Pfam:TPR_7 1 36 1.9e-4 PFAM
Pfam:TPR_10 75 112 7.8e-9 PFAM
Pfam:TPR_1 77 98 1.4e-4 PFAM
Pfam:TPR_7 78 129 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141435
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are significantly smaller than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Klc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Klc1 APN 12 111776884 missense probably damaging 1.00
IGL00940:Klc1 APN 12 111787498 missense probably damaging 1.00
IGL02206:Klc1 APN 12 111778116 unclassified probably benign
IGL02487:Klc1 APN 12 111772452 missense probably damaging 0.99
IGL02490:Klc1 APN 12 111781776 missense possibly damaging 0.89
IGL02830:Klc1 APN 12 111776907 missense probably damaging 0.99
IGL03121:Klc1 APN 12 111781642 unclassified probably benign
IGL03253:Klc1 APN 12 111781644 unclassified probably benign
IGL03376:Klc1 APN 12 111775953 missense probably damaging 0.97
dwarf UTSW 12 111795603 missense probably damaging 1.00
F5770:Klc1 UTSW 12 111774572 missense probably benign 0.09
R0031:Klc1 UTSW 12 111777033 missense probably damaging 0.99
R0239:Klc1 UTSW 12 111785324 splice site probably benign
R1647:Klc1 UTSW 12 111776887 missense probably damaging 1.00
R1648:Klc1 UTSW 12 111776887 missense probably damaging 1.00
R1892:Klc1 UTSW 12 111781827 critical splice donor site probably null
R2940:Klc1 UTSW 12 111806017 missense possibly damaging 0.49
R4829:Klc1 UTSW 12 111795603 missense probably damaging 1.00
R4849:Klc1 UTSW 12 111781695 missense probably damaging 1.00
R5312:Klc1 UTSW 12 111795621 missense possibly damaging 0.82
R5637:Klc1 UTSW 12 111774408 missense probably damaging 1.00
R5706:Klc1 UTSW 12 111795627 missense possibly damaging 0.65
R6623:Klc1 UTSW 12 111806041 missense probably damaging 1.00
R6920:Klc1 UTSW 12 111787585 missense probably damaging 1.00
R7109:Klc1 UTSW 12 111776865 missense probably benign 0.22
V7580:Klc1 UTSW 12 111774572 missense probably benign 0.09
V7581:Klc1 UTSW 12 111774572 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTAACATGTCTGTGCTCACTGC -3'
(R):5'- GAACAGAATCAAGGCGCTCC -3'

Sequencing Primer
(F):5'- TCTGGCAGGACTCACGTG -3'
(R):5'- TTTGAGCCTCGACCAGCCAG -3'
Posted On2016-07-22