Incidental Mutation 'R5309:Rnf5'
ID404748
Institutional Source Beutler Lab
Gene Symbol Rnf5
Ensembl Gene ENSMUSG00000015478
Gene Namering finger protein 5
Synonyms2410131O05Rik
MMRRC Submission 042892-MU
Accession Numbers

Genbank: NM_019403; MGI: 1860076

Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R5309 (G1)
Quality Score179
Status Validated
Chromosome17
Chromosomal Location34601091-34603690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34601588 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 175 (F175S)
Ref Sequence ENSEMBL: ENSMUSP00000015622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015596] [ENSMUST00000015622] [ENSMUST00000037489] [ENSMUST00000038149] [ENSMUST00000173242] [ENSMUST00000173328] [ENSMUST00000173973] [ENSMUST00000173992] [ENSMUST00000174041] [ENSMUST00000174069] [ENSMUST00000174228] [ENSMUST00000174496]
Predicted Effect probably benign
Transcript: ENSMUST00000015596
SMART Domains Protein: ENSMUSP00000015596
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 4.3e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015622
AA Change: F175S

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000015622
Gene: ENSMUSG00000015478
AA Change: F175S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
RING 27 67 1.5e-8 SMART
transmembrane domain 118 140 N/A INTRINSIC
transmembrane domain 160 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037489
SMART Domains Protein: ENSMUSP00000048573
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 210 4.64e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038149
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172932
SMART Domains Protein: ENSMUSP00000133660
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173242
SMART Domains Protein: ENSMUSP00000134242
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
Pfam:Acyltransferase 80 149 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173328
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173589
SMART Domains Protein: ENSMUSP00000133845
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173973
SMART Domains Protein: ENSMUSP00000133947
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173992
SMART Domains Protein: ENSMUSP00000134579
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 108 3.23e-7 SMART
Pfam:C2-set_2 114 208 3.3e-24 PFAM
IGc2 239 297 7.63e-18 SMART
transmembrane domain 321 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174041
SMART Domains Protein: ENSMUSP00000133441
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 198 6.63e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174045
Predicted Effect probably benign
Transcript: ENSMUST00000174069
SMART Domains Protein: ENSMUSP00000133391
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 2.5e-24 PFAM
IGc2 248 306 7.63e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174228
SMART Domains Protein: ENSMUSP00000133876
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174475
Predicted Effect probably benign
Transcript: ENSMUST00000174496
SMART Domains Protein: ENSMUSP00000134401
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 3.4e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184846
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, which is a motif known to be involved in protein-protein interactions. This protein is a membrane-bound ubiquitin ligase. It can regulate cell motility by targeting paxillin ubiquitination and altering the distribution and localization of paxillin in cytoplasm and cell focal adhesions. [provided by RefSeq, Jul 2008]
PHENOTYPE: When subjected to muscle damage by cardiotoxin treatment, mice homozygous for a targeted null mutation display attenuated muscle regeneration associated with a delayed ER stress response. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted, knock-out(2) Gene trapped(12)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Rnf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Rnf5 APN 17 34602109 missense probably damaging 1.00
N/A - 535:Rnf5 UTSW 17 34603356 missense possibly damaging 0.92
PIT1430001:Rnf5 UTSW 17 34603367 missense probably damaging 0.98
R3034:Rnf5 UTSW 17 34603358 missense possibly damaging 0.92
R3785:Rnf5 UTSW 17 34601932 critical splice donor site probably null
R4842:Rnf5 UTSW 17 34602003 unclassified probably benign
R5312:Rnf5 UTSW 17 34601588 missense probably benign 0.23
R5610:Rnf5 UTSW 17 34601738 unclassified probably benign
R6432:Rnf5 UTSW 17 34602127 missense possibly damaging 0.85
R6454:Rnf5 UTSW 17 34602309 missense probably damaging 0.99
X0028:Rnf5 UTSW 17 34601954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCACTCCCATCTTAAG -3'
(R):5'- TTCACCACCGTGTTCAATGC -3'

Sequencing Primer
(F):5'- TAAGCAGACTGGTCACTCCTCG -3'
(R):5'- TGCCCATGAACCTTTCAGAAGAGG -3'
Posted On2016-07-22