Incidental Mutation 'R5310:Alms1'
ID404778
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene NameALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location85587531-85702753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85615368 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 870 (S870T)
Ref Sequence ENSEMBL: ENSMUSP00000148796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
Predicted Effect probably benign
Transcript: ENSMUST00000072018
AA Change: S401T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: S401T

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213058
AA Change: S870T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCAACCAAGTGTCAAATTAAT -3'
(R):5'- AGTCAAGCTGTGGGGCATTT -3'

Sequencing Primer
(F):5'- ATTAGCCAGGCTTCTCCA -3'
(R):5'- TAAGCAGCATTCCTCCAAGGTTC -3'
Posted On2016-07-22