Incidental Mutation 'R5310:Cyp4f13'
ID404815
Institutional Source Beutler Lab
Gene Symbol Cyp4f13
Ensembl Gene ENSMUSG00000024055
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 13
Synonyms0610030I10Rik, P450 CYP4F13, leukotriene B4 omega hydroxylase
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32924688-32947402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32925821 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 372 (D372G)
Ref Sequence ENSEMBL: ENSMUSP00000074733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075253] [ENSMUST00000137222] [ENSMUST00000139353]
Predicted Effect probably damaging
Transcript: ENSMUST00000075253
AA Change: D372G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074733
Gene: ENSMUSG00000024055
AA Change: D372G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 514 1.9e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123653
Predicted Effect probably benign
Transcript: ENSMUST00000137222
SMART Domains Protein: ENSMUSP00000123495
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139353
AA Change: D263G

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123282
Gene: ENSMUSG00000024055
AA Change: D263G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 60 405 7.8e-108 PFAM
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F3, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F8, is approximately 18 kb away. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Cyp4f13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Cyp4f13 APN 17 32941164 missense probably benign 0.00
IGL01835:Cyp4f13 APN 17 32930614 missense probably benign 0.39
IGL02234:Cyp4f13 APN 17 32924774 utr 3 prime probably benign
IGL02437:Cyp4f13 APN 17 32930608 missense probably benign 0.12
IGL02465:Cyp4f13 APN 17 32929136 critical splice donor site probably null
IGL02604:Cyp4f13 APN 17 32932421 missense probably benign 0.01
IGL02934:Cyp4f13 APN 17 32929871 missense probably damaging 1.00
IGL03177:Cyp4f13 APN 17 32946914 missense possibly damaging 0.88
R0117:Cyp4f13 UTSW 17 32930606 missense probably damaging 0.98
R0138:Cyp4f13 UTSW 17 32941106 missense possibly damaging 0.63
R0220:Cyp4f13 UTSW 17 32929502 missense probably damaging 1.00
R0243:Cyp4f13 UTSW 17 32924969 splice site probably benign
R0357:Cyp4f13 UTSW 17 32932651 nonsense probably null
R1078:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R1757:Cyp4f13 UTSW 17 32929958 missense probably damaging 1.00
R1990:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R2351:Cyp4f13 UTSW 17 32925596 missense probably benign 0.01
R4704:Cyp4f13 UTSW 17 32925735 missense probably damaging 1.00
R4865:Cyp4f13 UTSW 17 32925704 missense probably damaging 1.00
R5004:Cyp4f13 UTSW 17 32925786 missense probably benign 0.39
R5574:Cyp4f13 UTSW 17 32929205 missense probably benign 0.39
R5996:Cyp4f13 UTSW 17 32929473 missense possibly damaging 0.87
R6190:Cyp4f13 UTSW 17 32929873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTGAGTAAGGAGACAGGTC -3'
(R):5'- CTGACAAGTCTCTTCTGGCC -3'

Sequencing Primer
(F):5'- GTCAGGTCCACGATGCTTCTG -3'
(R):5'- TTCTGGCCTCCACAGACATATAG -3'
Posted On2016-07-22