Incidental Mutation 'R5311:Tmem8b'
ID404837
Institutional Source Beutler Lab
Gene Symbol Tmem8b
Ensembl Gene ENSMUSG00000078716
Gene Nametransmembrane protein 8B
Synonyms
MMRRC Submission 042894-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5311 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43668971-43692668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43673992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 208 (V208I)
Ref Sequence ENSEMBL: ENSMUSP00000103498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056474] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000143339] [ENSMUST00000167153]
Predicted Effect probably benign
Transcript: ENSMUST00000056474
SMART Domains Protein: ENSMUSP00000057398
Gene: ENSMUSG00000043633

DomainStartEndE-ValueType
low complexity region 81 105 N/A INTRINSIC
internal_repeat_1 119 164 1.12e-19 PROSPERO
internal_repeat_1 165 210 1.12e-19 PROSPERO
low complexity region 267 285 N/A INTRINSIC
Pfam:DUF4475 312 482 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107866
AA Change: V208I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716
AA Change: V208I

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141864
Predicted Effect probably benign
Transcript: ENSMUST00000143339
SMART Domains Protein: ENSMUSP00000130133
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143774
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 A G 5: 142,467,687 K137E possibly damaging Het
Atm A C 9: 53,518,623 V371G probably benign Het
Cacna2d3 A G 14: 29,347,030 Y247H probably damaging Het
Ccdc180 T C 4: 45,917,556 V927A probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Edar G A 10: 58,607,435 P290S possibly damaging Het
Ext2 T C 2: 93,696,261 I677V probably benign Het
Fam53a A G 5: 33,607,736 S209P probably damaging Het
Fshr A T 17: 89,011,013 probably null Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gm14295 A T 2: 176,810,672 I652L probably benign Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm5431 T A 11: 48,888,889 E402V probably damaging Het
Gm6899 GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC GGAGGCCGCCCAGTGGCAGAGGC 11: 26,593,725 probably null Het
Itih2 T C 2: 10,110,535 D342G probably benign Het
Lgi2 A T 5: 52,554,485 D164E probably damaging Het
Lrriq1 A G 10: 103,214,587 I768T probably damaging Het
Map1a C A 2: 121,302,387 A990E probably damaging Het
Mdh1b A G 1: 63,720,004 V143A probably benign Het
Mrgprb3 C T 7: 48,643,311 C164Y probably damaging Het
Mtpap T A 18: 4,386,328 V316E probably damaging Het
Mybpc3 T A 2: 91,128,678 C655* probably null Het
Myh15 A G 16: 49,165,841 E1558G possibly damaging Het
Mylk A G 16: 34,921,757 T880A probably benign Het
Nckap1 T A 2: 80,540,122 D408V probably damaging Het
Nos3 A T 5: 24,377,345 H605L probably benign Het
Nrxn2 C A 19: 6,531,398 D411E probably benign Het
Olfr1057 T A 2: 86,374,750 I221L possibly damaging Het
Olfr366 T C 2: 37,219,621 V44A probably benign Het
Pde4d C A 13: 109,632,864 P29T probably benign Het
Pde4d C T 13: 109,632,865 P29L probably benign Het
Pkhd1 A G 1: 20,565,870 V412A possibly damaging Het
Rev1 T A 1: 38,079,393 I480L probably benign Het
Rimbp3 A G 16: 17,210,844 T711A probably benign Het
RP23-191E1.1 T A 3: 106,297,468 noncoding transcript Het
Serpina11 A T 12: 103,985,962 I183N probably damaging Het
Siglec1 T C 2: 131,079,316 H645R probably damaging Het
Skint7 G A 4: 111,980,304 R93H probably damaging Het
Slfn8 T C 11: 83,004,084 E632G probably damaging Het
Trps1 G A 15: 50,664,760 T658I probably damaging Het
Ubash3a A G 17: 31,219,717 T287A probably damaging Het
Ugt2b35 G A 5: 87,011,280 W444* probably null Het
Vmn1r219 T A 13: 23,162,893 V84D probably damaging Het
Vmn2r10 T C 5: 109,006,255 Y61C probably damaging Het
Vmn2r104 G A 17: 20,029,901 P703S probably damaging Het
Wdsub1 T A 2: 59,878,529 probably benign Het
Zfp667 A G 7: 6,305,716 Q461R probably benign Het
Zfp941 C A 7: 140,811,959 G496* probably null Het
Other mutations in Tmem8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Tmem8b APN 4 43689434 missense probably benign 0.15
IGL02677:Tmem8b APN 4 43686092 missense probably damaging 1.00
IGL03090:Tmem8b APN 4 43689721 missense probably damaging 0.99
IGL03379:Tmem8b APN 4 43685561 missense probably benign 0.42
R0321:Tmem8b UTSW 4 43674444 missense probably damaging 1.00
R0377:Tmem8b UTSW 4 43674005 missense probably damaging 1.00
R0456:Tmem8b UTSW 4 43685618 missense probably benign 0.04
R0629:Tmem8b UTSW 4 43669896 utr 5 prime probably null
R0646:Tmem8b UTSW 4 43690123 missense probably benign 0.01
R0690:Tmem8b UTSW 4 43674562 missense possibly damaging 0.69
R1484:Tmem8b UTSW 4 43690234 missense probably benign 0.01
R1558:Tmem8b UTSW 4 43681134 missense possibly damaging 0.95
R1733:Tmem8b UTSW 4 43690228 unclassified probably null
R1999:Tmem8b UTSW 4 43681300 missense probably damaging 0.99
R2414:Tmem8b UTSW 4 43673892 splice site probably benign
R3799:Tmem8b UTSW 4 43673892 splice site probably benign
R3820:Tmem8b UTSW 4 43689745 missense probably damaging 0.99
R3821:Tmem8b UTSW 4 43689745 missense probably damaging 0.99
R4581:Tmem8b UTSW 4 43685760 missense probably damaging 1.00
R4852:Tmem8b UTSW 4 43689713 missense probably damaging 0.99
R5214:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5448:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5449:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R5450:Tmem8b UTSW 4 43673992 missense probably benign 0.09
R6245:Tmem8b UTSW 4 43690246 missense probably benign 0.14
R6615:Tmem8b UTSW 4 43682249 missense probably damaging 1.00
R6693:Tmem8b UTSW 4 43669837 missense probably benign 0.00
R6944:Tmem8b UTSW 4 43674465 missense probably damaging 1.00
R6994:Tmem8b UTSW 4 43690192 missense probably damaging 0.96
R7136:Tmem8b UTSW 4 43669845 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GAAAGTGCTGTTGACCTGGTC -3'
(R):5'- CAACCTGGATAAGGGTCAAGTTC -3'

Sequencing Primer
(F):5'- CCTGTTGGTGAGAAGGTGACC -3'
(R):5'- GTCAAGAGGCATGTTTAGACCCC -3'
Posted On2016-07-22