Incidental Mutation 'R5322:Cachd1'
ID404889
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Namecache domain containing 1
SynonymsVwcd1, B430218L07Rik, 1190007F10Rik
MMRRC Submission 042905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R5322 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location100776675-101029220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100952122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 268 (I268T)
Ref Sequence ENSEMBL: ENSMUSP00000095568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
Predicted Effect probably damaging
Transcript: ENSMUST00000030257
AA Change: I268T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: I268T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097955
AA Change: I268T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: I268T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,520,562 I349T probably benign Het
Adamts3 C T 5: 89,707,300 probably null Het
Ankar T C 1: 72,690,386 probably null Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Appbp2 A G 11: 85,196,064 probably null Het
Arvcf T C 16: 18,397,643 M176T probably benign Het
Ccdc66 A G 14: 27,482,527 S933P probably damaging Het
Cfi C T 3: 129,873,040 P471S probably damaging Het
Ckmt2 G T 13: 91,861,772 T143K possibly damaging Het
Cnksr3 A T 10: 7,135,078 D15E probably damaging Het
Copb2 A T 9: 98,585,976 K680N probably benign Het
D2hgdh T C 1: 93,829,898 probably null Het
Dcn A T 10: 97,517,602 T338S probably benign Het
Dnah10 G A 5: 124,773,566 G1644D probably damaging Het
Dnah5 A G 15: 28,384,244 I3045V probably benign Het
Dock3 G A 9: 106,901,829 T307I probably benign Het
Dock5 A T 14: 67,770,266 I1498N probably benign Het
Emc1 A T 4: 139,354,246 N62Y probably damaging Het
Enpp6 C A 8: 47,068,915 H295N probably benign Het
Epha10 A G 4: 124,885,748 Y129C probably damaging Het
Fbn2 A T 18: 58,039,315 D2139E probably benign Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fignl1 A T 11: 11,801,571 F495I probably damaging Het
Gm43302 C T 5: 105,217,481 A554T probably benign Het
Gpr157 A G 4: 150,098,852 N160D probably benign Het
Il1rn G A 2: 24,348,629 probably null Het
Kctd13 T A 7: 126,929,206 L51Q probably damaging Het
Kndc1 T C 7: 139,936,809 F1561L probably damaging Het
Mast2 A G 4: 116,333,411 probably null Het
Mib1 A G 18: 10,792,975 H637R probably damaging Het
Moxd1 A T 10: 24,244,253 N93I possibly damaging Het
Mycbp2 T C 14: 103,185,683 probably null Het
Myot T C 18: 44,354,149 F351S probably benign Het
N4bp2 T A 5: 65,790,457 N143K possibly damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr243 T A 7: 103,717,112 W173R probably benign Het
Olfr455 T C 6: 42,539,016 D2G probably benign Het
Olfr623 T C 7: 103,660,672 I193V possibly damaging Het
Olfr666 C T 7: 104,893,164 V155I probably benign Het
Olfr917 T A 9: 38,665,206 I213L probably benign Het
Patl1 C T 19: 11,920,859 R134* probably null Het
Paxbp1 T C 16: 91,015,162 I887V probably benign Het
Pi4kb G A 3: 94,994,249 R436Q probably benign Het
Pla2g3 A G 11: 3,488,686 E112G probably benign Het
Ppp2r2a A G 14: 67,038,873 probably null Het
Rela T A 19: 5,645,380 S311R possibly damaging Het
Sidt1 T A 16: 44,281,622 probably benign Het
Smco2 T C 6: 146,871,287 L329P probably damaging Het
Speer4f1 A T 5: 17,477,349 I77F possibly damaging Het
Tex14 A G 11: 87,511,472 I462V probably benign Het
Tmem260 C T 14: 48,486,849 R385W probably damaging Het
Trrap T C 5: 144,844,224 V2974A probably damaging Het
Usp47 C T 7: 112,053,269 T31I probably damaging Het
Zc2hc1a A G 3: 7,551,421 N247S probably benign Het
Zeb2 A C 2: 44,997,095 M582R probably damaging Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100966966 missense probably benign 0.05
IGL01531:Cachd1 APN 4 100953034 missense probably benign 0.02
IGL01705:Cachd1 APN 4 100983539 missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100992872 missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100974128 missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100952097 missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100968098 missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100952085 missense probably damaging 0.98
IGL03084:Cachd1 APN 4 101003088 missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100994737 missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100953205 missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100897703 missense probably damaging 0.99
R0578:Cachd1 UTSW 4 100994842 splice site probably benign
R0646:Cachd1 UTSW 4 100988221 missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100974876 missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100983301 splice site probably benign
R1156:Cachd1 UTSW 4 100988619 missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100974840 missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100974917 missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100988598 missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100966972 missense probably benign 0.02
R1774:Cachd1 UTSW 4 100964435 missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100967043 missense probably benign 0.02
R1845:Cachd1 UTSW 4 100777358 missense probably benign 0.01
R1869:Cachd1 UTSW 4 100983390 missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100953169 missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100990844 missense probably damaging 1.00
R2082:Cachd1 UTSW 4 101002958 missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100949069 splice site probably benign
R2517:Cachd1 UTSW 4 100980882 intron probably null
R2896:Cachd1 UTSW 4 100970903 missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100974880 nonsense probably null
R3818:Cachd1 UTSW 4 100990865 missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100970888 missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100953130 nonsense probably null
R4791:Cachd1 UTSW 4 100918085 missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100994738 missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100964491 missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100966200 missense possibly damaging 0.94
R5335:Cachd1 UTSW 4 100968085 missense possibly damaging 0.88
R5390:Cachd1 UTSW 4 100981006 missense probably damaging 1.00
R5573:Cachd1 UTSW 4 100974079 missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100865006 missense probably benign 0.31
R5905:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100952019 missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100981031 nonsense probably null
R6367:Cachd1 UTSW 4 101002970 missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100952118 missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100989486 missense probably benign
R6691:Cachd1 UTSW 4 100989486 missense probably benign
R7129:Cachd1 UTSW 4 100918066 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGTCTGAGCTCACTCTG -3'
(R):5'- CGTGATAGTTGTATGGGGCCAC -3'

Sequencing Primer
(F):5'- TGACTTGTACCATCCCCCAGAAG -3'
(R):5'- ACTGGCGCTCTCTGGTC -3'
Posted On2016-07-22