Incidental Mutation 'R5322:Mast2'
ID404890
Institutional Source Beutler Lab
Gene Symbol Mast2
Ensembl Gene ENSMUSG00000003810
Gene Namemicrotubule associated serine/threonine kinase 2
SynonymsMAST205, Mtssk
MMRRC Submission 042905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5322 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116306762-116464183 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 116333411 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486] [ENSMUST00000123072] [ENSMUST00000144281]
Predicted Effect probably benign
Transcript: ENSMUST00000003908
SMART Domains Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 416 1.8e-148 PFAM
S_TKc 452 725 2.96e-99 SMART
S_TK_X 726 786 1.08e-1 SMART
low complexity region 849 861 N/A INTRINSIC
low complexity region 1009 1028 N/A INTRINSIC
PDZ 1049 1129 2.23e-12 SMART
low complexity region 1142 1157 N/A INTRINSIC
low complexity region 1177 1210 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
low complexity region 1279 1302 N/A INTRINSIC
low complexity region 1345 1360 N/A INTRINSIC
low complexity region 1437 1452 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106484
SMART Domains Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 423 1.3e-151 PFAM
S_TKc 459 732 2.96e-99 SMART
S_TK_X 733 793 1.08e-1 SMART
low complexity region 856 868 N/A INTRINSIC
low complexity region 1016 1035 N/A INTRINSIC
PDZ 1056 1136 2.23e-12 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1184 1217 N/A INTRINSIC
low complexity region 1233 1255 N/A INTRINSIC
low complexity region 1285 1308 N/A INTRINSIC
low complexity region 1351 1366 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106485
SMART Domains Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 477 1.1e-148 PFAM
S_TKc 513 786 2.96e-99 SMART
S_TK_X 787 847 1.08e-1 SMART
low complexity region 910 922 N/A INTRINSIC
low complexity region 1070 1089 N/A INTRINSIC
PDZ 1110 1190 2.23e-12 SMART
low complexity region 1203 1218 N/A INTRINSIC
low complexity region 1238 1271 N/A INTRINSIC
low complexity region 1285 1310 N/A INTRINSIC
low complexity region 1340 1363 N/A INTRINSIC
low complexity region 1406 1421 N/A INTRINSIC
low complexity region 1498 1513 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106486
SMART Domains Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 483 2.9e-143 PFAM
S_TKc 520 793 2.96e-99 SMART
S_TK_X 794 854 1.08e-1 SMART
low complexity region 917 929 N/A INTRINSIC
low complexity region 1077 1096 N/A INTRINSIC
PDZ 1117 1197 2.23e-12 SMART
low complexity region 1210 1225 N/A INTRINSIC
low complexity region 1245 1278 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1346 1369 N/A INTRINSIC
low complexity region 1412 1427 N/A INTRINSIC
low complexity region 1504 1519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123072
SMART Domains Protein: ENSMUSP00000118340
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
Pfam:DUF1908 58 203 2.9e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134460
Predicted Effect probably benign
Transcript: ENSMUST00000144281
SMART Domains Protein: ENSMUSP00000122625
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
Pfam:DUF1908 57 144 2.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151347
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,520,562 I349T probably benign Het
Adamts3 C T 5: 89,707,300 probably null Het
Ankar T C 1: 72,690,386 probably null Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Appbp2 A G 11: 85,196,064 probably null Het
Arvcf T C 16: 18,397,643 M176T probably benign Het
Cachd1 T C 4: 100,952,122 I268T probably damaging Het
Ccdc66 A G 14: 27,482,527 S933P probably damaging Het
Cfi C T 3: 129,873,040 P471S probably damaging Het
Ckmt2 G T 13: 91,861,772 T143K possibly damaging Het
Cnksr3 A T 10: 7,135,078 D15E probably damaging Het
Copb2 A T 9: 98,585,976 K680N probably benign Het
D2hgdh T C 1: 93,829,898 probably null Het
Dcn A T 10: 97,517,602 T338S probably benign Het
Dnah10 G A 5: 124,773,566 G1644D probably damaging Het
Dnah5 A G 15: 28,384,244 I3045V probably benign Het
Dock3 G A 9: 106,901,829 T307I probably benign Het
Dock5 A T 14: 67,770,266 I1498N probably benign Het
Emc1 A T 4: 139,354,246 N62Y probably damaging Het
Enpp6 C A 8: 47,068,915 H295N probably benign Het
Epha10 A G 4: 124,885,748 Y129C probably damaging Het
Fbn2 A T 18: 58,039,315 D2139E probably benign Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fignl1 A T 11: 11,801,571 F495I probably damaging Het
Gm43302 C T 5: 105,217,481 A554T probably benign Het
Gpr157 A G 4: 150,098,852 N160D probably benign Het
Il1rn G A 2: 24,348,629 probably null Het
Kctd13 T A 7: 126,929,206 L51Q probably damaging Het
Kndc1 T C 7: 139,936,809 F1561L probably damaging Het
Mib1 A G 18: 10,792,975 H637R probably damaging Het
Moxd1 A T 10: 24,244,253 N93I possibly damaging Het
Mycbp2 T C 14: 103,185,683 probably null Het
Myot T C 18: 44,354,149 F351S probably benign Het
N4bp2 T A 5: 65,790,457 N143K possibly damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr243 T A 7: 103,717,112 W173R probably benign Het
Olfr455 T C 6: 42,539,016 D2G probably benign Het
Olfr623 T C 7: 103,660,672 I193V possibly damaging Het
Olfr666 C T 7: 104,893,164 V155I probably benign Het
Olfr917 T A 9: 38,665,206 I213L probably benign Het
Patl1 C T 19: 11,920,859 R134* probably null Het
Paxbp1 T C 16: 91,015,162 I887V probably benign Het
Pi4kb G A 3: 94,994,249 R436Q probably benign Het
Pla2g3 A G 11: 3,488,686 E112G probably benign Het
Ppp2r2a A G 14: 67,038,873 probably null Het
Rela T A 19: 5,645,380 S311R possibly damaging Het
Sidt1 T A 16: 44,281,622 probably benign Het
Smco2 T C 6: 146,871,287 L329P probably damaging Het
Speer4f1 A T 5: 17,477,349 I77F possibly damaging Het
Tex14 A G 11: 87,511,472 I462V probably benign Het
Tmem260 C T 14: 48,486,849 R385W probably damaging Het
Trrap T C 5: 144,844,224 V2974A probably damaging Het
Usp47 C T 7: 112,053,269 T31I probably damaging Het
Zc2hc1a A G 3: 7,551,421 N247S probably benign Het
Zeb2 A C 2: 44,997,095 M582R probably damaging Het
Other mutations in Mast2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Mast2 APN 4 116311329 missense probably benign 0.39
IGL00916:Mast2 APN 4 116327633 missense possibly damaging 0.88
IGL02112:Mast2 APN 4 116319764 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116307987 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116312846 splice site probably benign
R0883:Mast2 UTSW 4 116311767 missense probably damaging 1.00
R1447:Mast2 UTSW 4 116312013 missense probably benign 0.02
R1449:Mast2 UTSW 4 116309013 missense probably damaging 1.00
R1473:Mast2 UTSW 4 116311955 missense probably damaging 1.00
R1491:Mast2 UTSW 4 116316491 missense possibly damaging 0.90
R1529:Mast2 UTSW 4 116430519 missense probably benign 0.17
R1654:Mast2 UTSW 4 116316550 critical splice acceptor site probably null
R1768:Mast2 UTSW 4 116306959 missense probably damaging 1.00
R1807:Mast2 UTSW 4 116310741 splice site probably benign
R1981:Mast2 UTSW 4 116314840 missense probably damaging 1.00
R2081:Mast2 UTSW 4 116330474 splice site probably null
R2157:Mast2 UTSW 4 116322283 missense probably damaging 1.00
R3409:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3411:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3434:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3435:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3953:Mast2 UTSW 4 116313729 missense probably damaging 1.00
R4056:Mast2 UTSW 4 116337501 splice site probably benign
R4153:Mast2 UTSW 4 116315963 missense possibly damaging 0.91
R4648:Mast2 UTSW 4 116314839 nonsense probably null
R4671:Mast2 UTSW 4 116308650 missense probably damaging 1.00
R4911:Mast2 UTSW 4 116353057 missense probably benign 0.36
R4980:Mast2 UTSW 4 116317751 missense probably damaging 1.00
R5462:Mast2 UTSW 4 116307458 missense probably damaging 0.99
R5586:Mast2 UTSW 4 116435563 missense probably damaging 0.99
R5750:Mast2 UTSW 4 116308889 intron probably benign
R5771:Mast2 UTSW 4 116333425 missense possibly damaging 0.60
R5885:Mast2 UTSW 4 116314838 missense probably damaging 1.00
R6230:Mast2 UTSW 4 116326098 missense probably damaging 1.00
R6347:Mast2 UTSW 4 116317732 missense probably damaging 1.00
R6527:Mast2 UTSW 4 116314939 missense probably damaging 0.99
R6619:Mast2 UTSW 4 116316497 nonsense probably null
R7070:Mast2 UTSW 4 116310855 missense probably benign 0.03
R7303:Mast2 UTSW 4 116308311 missense possibly damaging 0.63
X0003:Mast2 UTSW 4 116307647 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAACAGGGAGTACTGAGATCC -3'
(R):5'- CCAGGTGTGTAGAGTAAGGATCC -3'

Sequencing Primer
(F):5'- GGAGTACTGAGATCCCATATGCC -3'
(R):5'- TGTAGAGTAAGGATCCCTTCAGG -3'
Posted On2016-07-22