Incidental Mutation 'R5322:Olfr623'
ID404902
Institutional Source Beutler Lab
Gene Symbol Olfr623
Ensembl Gene ENSMUSG00000099687
Gene Nameolfactory receptor 623
SynonymsMOR1-4, GA_x6K02T2PBJ9-6384836-6383883
MMRRC Submission 042905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5322 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103657697-103663698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103660672 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 193 (I193V)
Ref Sequence ENSEMBL: ENSMUSP00000150141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144] [ENSMUST00000068531] [ENSMUST00000213840]
Predicted Effect probably benign
Transcript: ENSMUST00000062144
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000068531
AA Change: I193V

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070658
Gene: ENSMUSG00000099687
AA Change: I193V

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1.7e-112 PFAM
Pfam:7TM_GPCR_Srsx 36 299 3.1e-7 PFAM
Pfam:7tm_1 42 293 2.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213840
AA Change: I193V

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,520,562 I349T probably benign Het
Adamts3 C T 5: 89,707,300 probably null Het
Ankar T C 1: 72,690,386 probably null Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Appbp2 A G 11: 85,196,064 probably null Het
Arvcf T C 16: 18,397,643 M176T probably benign Het
Cachd1 T C 4: 100,952,122 I268T probably damaging Het
Ccdc66 A G 14: 27,482,527 S933P probably damaging Het
Cfi C T 3: 129,873,040 P471S probably damaging Het
Ckmt2 G T 13: 91,861,772 T143K possibly damaging Het
Cnksr3 A T 10: 7,135,078 D15E probably damaging Het
Copb2 A T 9: 98,585,976 K680N probably benign Het
D2hgdh T C 1: 93,829,898 probably null Het
Dcn A T 10: 97,517,602 T338S probably benign Het
Dnah10 G A 5: 124,773,566 G1644D probably damaging Het
Dnah5 A G 15: 28,384,244 I3045V probably benign Het
Dock3 G A 9: 106,901,829 T307I probably benign Het
Dock5 A T 14: 67,770,266 I1498N probably benign Het
Emc1 A T 4: 139,354,246 N62Y probably damaging Het
Enpp6 C A 8: 47,068,915 H295N probably benign Het
Epha10 A G 4: 124,885,748 Y129C probably damaging Het
Fbn2 A T 18: 58,039,315 D2139E probably benign Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fignl1 A T 11: 11,801,571 F495I probably damaging Het
Gm43302 C T 5: 105,217,481 A554T probably benign Het
Gpr157 A G 4: 150,098,852 N160D probably benign Het
Il1rn G A 2: 24,348,629 probably null Het
Kctd13 T A 7: 126,929,206 L51Q probably damaging Het
Kndc1 T C 7: 139,936,809 F1561L probably damaging Het
Mast2 A G 4: 116,333,411 probably null Het
Mib1 A G 18: 10,792,975 H637R probably damaging Het
Moxd1 A T 10: 24,244,253 N93I possibly damaging Het
Mycbp2 T C 14: 103,185,683 probably null Het
Myot T C 18: 44,354,149 F351S probably benign Het
N4bp2 T A 5: 65,790,457 N143K possibly damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr243 T A 7: 103,717,112 W173R probably benign Het
Olfr455 T C 6: 42,539,016 D2G probably benign Het
Olfr666 C T 7: 104,893,164 V155I probably benign Het
Olfr917 T A 9: 38,665,206 I213L probably benign Het
Patl1 C T 19: 11,920,859 R134* probably null Het
Paxbp1 T C 16: 91,015,162 I887V probably benign Het
Pi4kb G A 3: 94,994,249 R436Q probably benign Het
Pla2g3 A G 11: 3,488,686 E112G probably benign Het
Ppp2r2a A G 14: 67,038,873 probably null Het
Rela T A 19: 5,645,380 S311R possibly damaging Het
Sidt1 T A 16: 44,281,622 probably benign Het
Smco2 T C 6: 146,871,287 L329P probably damaging Het
Speer4f1 A T 5: 17,477,349 I77F possibly damaging Het
Tex14 A G 11: 87,511,472 I462V probably benign Het
Tmem260 C T 14: 48,486,849 R385W probably damaging Het
Trrap T C 5: 144,844,224 V2974A probably damaging Het
Usp47 C T 7: 112,053,269 T31I probably damaging Het
Zc2hc1a A G 3: 7,551,421 N247S probably benign Het
Zeb2 A C 2: 44,997,095 M582R probably damaging Het
Other mutations in Olfr623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Olfr623 APN 7 103661067 missense probably damaging 0.99
IGL01669:Olfr623 APN 7 103660987 missense probably benign 0.02
IGL01731:Olfr623 APN 7 103660846 missense probably benign 0.01
IGL02057:Olfr623 APN 7 103660653 missense probably damaging 1.00
IGL02249:Olfr623 APN 7 103660366 missense probably damaging 0.99
IGL02937:Olfr623 APN 7 103660905 missense probably damaging 1.00
IGL03113:Olfr623 APN 7 103660644 missense possibly damaging 0.90
R0413:Olfr623 UTSW 7 103660750 missense possibly damaging 0.52
R0862:Olfr623 UTSW 7 103660528 missense probably damaging 1.00
R1262:Olfr623 UTSW 7 103660441 missense probably benign 0.33
R1791:Olfr623 UTSW 7 103660798 unclassified probably null
R2327:Olfr623 UTSW 7 103660572 missense probably damaging 1.00
R2338:Olfr623 UTSW 7 103660410 missense possibly damaging 0.90
R4521:Olfr623 UTSW 7 103660332 missense probably benign 0.01
R4831:Olfr623 UTSW 7 103660471 missense probably benign 0.40
R6270:Olfr623 UTSW 7 103660413 missense possibly damaging 0.48
R6959:Olfr623 UTSW 7 103660843 missense probably damaging 1.00
R7157:Olfr623 UTSW 7 103660581 missense probably damaging 1.00
R7181:Olfr623 UTSW 7 103660813 missense probably damaging 0.99
X0066:Olfr623 UTSW 7 103660660 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGGAAGCAGATGTAGCTCATTG -3'
(R):5'- GGCCTATGACCGTTTCATTGC -3'

Sequencing Primer
(F):5'- GAGGAATATTCTTTCCAAACCTGTG -3'
(R):5'- ATGACCGTTTCATTGCCATTCG -3'
Posted On2016-07-22