Incidental Mutation 'R5322:Myot'
ID404934
Institutional Source Beutler Lab
Gene Symbol Myot
Ensembl Gene ENSMUSG00000024471
Gene Namemyotilin
SynonymsTtid, 5530402I04Rik
MMRRC Submission 042905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5322 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location44334074-44355724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44354149 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 351 (F351S)
Ref Sequence ENSEMBL: ENSMUSP00000111160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025349] [ENSMUST00000115498]
Predicted Effect probably benign
Transcript: ENSMUST00000025349
AA Change: F351S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025349
Gene: ENSMUSG00000024471
AA Change: F351S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
IG 254 339 5.84e-5 SMART
IGc2 359 428 5.53e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115498
AA Change: F351S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111160
Gene: ENSMUSG00000024471
AA Change: F351S

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
IG 254 339 5.84e-5 SMART
IGc2 359 428 5.53e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cystoskeletal protein which plays a significant role in the stability of thin filaments during muscle contraction. This protein binds F-actin, crosslinks actin filaments, and prevents latrunculin A-induced filament disassembly. Mutations in this gene have been associated with limb-girdle muscular dystrophy and myofibrillar myopathies. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with normal skeletal and cardiac muscle morphology and function, growth rate, survival, and internal organ morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,520,562 I349T probably benign Het
Adamts3 C T 5: 89,707,300 probably null Het
Ankar T C 1: 72,690,386 probably null Het
Ankrd60 T A 2: 173,568,817 K303N possibly damaging Het
Appbp2 A G 11: 85,196,064 probably null Het
Arvcf T C 16: 18,397,643 M176T probably benign Het
Cachd1 T C 4: 100,952,122 I268T probably damaging Het
Ccdc66 A G 14: 27,482,527 S933P probably damaging Het
Cfi C T 3: 129,873,040 P471S probably damaging Het
Ckmt2 G T 13: 91,861,772 T143K possibly damaging Het
Cnksr3 A T 10: 7,135,078 D15E probably damaging Het
Copb2 A T 9: 98,585,976 K680N probably benign Het
D2hgdh T C 1: 93,829,898 probably null Het
Dcn A T 10: 97,517,602 T338S probably benign Het
Dnah10 G A 5: 124,773,566 G1644D probably damaging Het
Dnah5 A G 15: 28,384,244 I3045V probably benign Het
Dock3 G A 9: 106,901,829 T307I probably benign Het
Dock5 A T 14: 67,770,266 I1498N probably benign Het
Emc1 A T 4: 139,354,246 N62Y probably damaging Het
Enpp6 C A 8: 47,068,915 H295N probably benign Het
Epha10 A G 4: 124,885,748 Y129C probably damaging Het
Fbn2 A T 18: 58,039,315 D2139E probably benign Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fignl1 A T 11: 11,801,571 F495I probably damaging Het
Gm43302 C T 5: 105,217,481 A554T probably benign Het
Gpr157 A G 4: 150,098,852 N160D probably benign Het
Il1rn G A 2: 24,348,629 probably null Het
Kctd13 T A 7: 126,929,206 L51Q probably damaging Het
Kndc1 T C 7: 139,936,809 F1561L probably damaging Het
Mast2 A G 4: 116,333,411 probably null Het
Mib1 A G 18: 10,792,975 H637R probably damaging Het
Moxd1 A T 10: 24,244,253 N93I possibly damaging Het
Mycbp2 T C 14: 103,185,683 probably null Het
N4bp2 T A 5: 65,790,457 N143K possibly damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr243 T A 7: 103,717,112 W173R probably benign Het
Olfr455 T C 6: 42,539,016 D2G probably benign Het
Olfr623 T C 7: 103,660,672 I193V possibly damaging Het
Olfr666 C T 7: 104,893,164 V155I probably benign Het
Olfr917 T A 9: 38,665,206 I213L probably benign Het
Patl1 C T 19: 11,920,859 R134* probably null Het
Paxbp1 T C 16: 91,015,162 I887V probably benign Het
Pi4kb G A 3: 94,994,249 R436Q probably benign Het
Pla2g3 A G 11: 3,488,686 E112G probably benign Het
Ppp2r2a A G 14: 67,038,873 probably null Het
Rela T A 19: 5,645,380 S311R possibly damaging Het
Sidt1 T A 16: 44,281,622 probably benign Het
Smco2 T C 6: 146,871,287 L329P probably damaging Het
Speer4f1 A T 5: 17,477,349 I77F possibly damaging Het
Tex14 A G 11: 87,511,472 I462V probably benign Het
Tmem260 C T 14: 48,486,849 R385W probably damaging Het
Trrap T C 5: 144,844,224 V2974A probably damaging Het
Usp47 C T 7: 112,053,269 T31I probably damaging Het
Zc2hc1a A G 3: 7,551,421 N247S probably benign Het
Zeb2 A C 2: 44,997,095 M582R probably damaging Het
Other mutations in Myot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Myot APN 18 44337114 missense possibly damaging 0.85
IGL02117:Myot APN 18 44355110 missense probably benign 0.36
IGL02812:Myot APN 18 44346060 missense probably damaging 1.00
R0178:Myot UTSW 18 44336986 missense probably damaging 1.00
R1512:Myot UTSW 18 44342355 missense probably damaging 1.00
R1620:Myot UTSW 18 44337058 missense possibly damaging 0.48
R2140:Myot UTSW 18 44354125 missense possibly damaging 0.53
R2234:Myot UTSW 18 44354272 missense probably damaging 0.98
R2235:Myot UTSW 18 44354272 missense probably damaging 0.98
R2568:Myot UTSW 18 44337216 missense probably benign 0.02
R3702:Myot UTSW 18 44354095 intron probably null
R4967:Myot UTSW 18 44354928 missense possibly damaging 0.68
R5154:Myot UTSW 18 44354214 missense probably benign
R5250:Myot UTSW 18 44346070 missense probably damaging 1.00
R7110:Myot UTSW 18 44341386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTAGCCAACATGTTATGGTATG -3'
(R):5'- CTGCCAACAAAAGATGAACTCTAGG -3'

Sequencing Primer
(F):5'- AGCCAACATGTTATGGTATGTTATC -3'
(R):5'- TTGTAGTGTGGGTAATAAGCATAAC -3'
Posted On2016-07-22