Incidental Mutation 'R5323:Mycbpap'
ID404978
Institutional Source Beutler Lab
Gene Symbol Mycbpap
Ensembl Gene ENSMUSG00000039110
Gene NameMYCBP associated protein
SynonymsAMAP-1, 4932408B01Rik
MMRRC Submission 042906-MU
Accession Numbers

NCBI RefSeq: NM_170671.2; MGI: 2388726

Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R5323 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94501347-94521742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94503504 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 313 (D313E)
Ref Sequence ENSEMBL: ENSMUSP00000047579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040692] [ENSMUST00000093945] [ENSMUST00000127305]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000010224
Predicted Effect probably benign
Transcript: ENSMUST00000040692
AA Change: D313E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047579
Gene: ENSMUSG00000039110
AA Change: D313E

DomainStartEndE-ValueType
Pfam:MYCBPAP 6 85 2.3e-19 PFAM
low complexity region 330 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093945
AA Change: D831E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091477
Gene: ENSMUSG00000039110
AA Change: D831E

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:MYCBPAP 184 602 3.7e-144 PFAM
low complexity region 848 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123496
Predicted Effect probably benign
Transcript: ENSMUST00000127305
SMART Domains Protein: ENSMUSP00000121390
Gene: ENSMUSG00000010080

DomainStartEndE-ValueType
ENTH 18 144 1.3e-62 SMART
low complexity region 167 190 N/A INTRINSIC
UIM 202 221 2.11e-2 SMART
UIM 229 248 5.27e-3 SMART
low complexity region 269 285 N/A INTRINSIC
low complexity region 554 572 N/A INTRINSIC
low complexity region 578 588 N/A INTRINSIC
low complexity region 599 618 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151993
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,557,061 C784S probably damaging Het
Ahnak2 A T 12: 112,779,812 probably benign Het
Apon A G 10: 128,255,038 E195G probably damaging Het
Atxn10 A G 15: 85,391,743 I334V probably benign Het
Camsap1 G T 2: 25,965,811 A145E probably damaging Het
Capns1 G T 7: 30,187,722 F243L possibly damaging Het
Catsper2 A T 2: 121,406,735 I228N probably damaging Het
Ceacam14 A T 7: 17,815,477 *264C probably null Het
Cel A C 2: 28,560,518 V165G probably damaging Het
Cldnd1 T A 16: 58,729,653 D66E possibly damaging Het
Cntnap5b T A 1: 100,383,550 C589* probably null Het
Dnah3 T A 7: 120,021,011 H1554L probably damaging Het
Fbxw25 T A 9: 109,663,505 M55L probably benign Het
Fn1 T C 1: 71,597,432 H2187R probably benign Het
Fsip2 A G 2: 82,988,145 T4741A possibly damaging Het
Gabpa T A 16: 84,857,046 I272N possibly damaging Het
Ganab T C 19: 8,908,685 S212P probably benign Het
Ggt1 A G 10: 75,585,661 probably null Het
Hpgds T C 6: 65,132,185 T81A probably benign Het
Insr G A 8: 3,202,902 T419I probably benign Het
Itgb7 A G 15: 102,231,624 probably benign Het
Kcnt1 A G 2: 25,909,277 I951V possibly damaging Het
Lrrc4c T A 2: 97,630,153 C375S probably damaging Het
Muc3 G T 5: 137,146,689 C44* probably null Het
Neo1 A G 9: 58,906,648 probably null Het
Ntsr2 C T 12: 16,659,933 S405F probably benign Het
Nup153 G A 13: 46,717,206 P21S probably benign Het
Obscn T A 11: 58,996,877 E7705D probably benign Het
Ogn A G 13: 49,609,341 D53G probably benign Het
Olfr116 A T 17: 37,624,155 I160K probably benign Het
Olfr1505 A T 19: 13,919,616 I199F possibly damaging Het
Olfr175-ps1 G A 16: 58,824,703 T2I probably benign Het
Olfr467 T C 7: 107,814,676 F33L possibly damaging Het
Olfr976 A T 9: 39,956,829 Y35* probably null Het
Pde6a G A 18: 61,232,911 R236H possibly damaging Het
Pigk T A 3: 152,738,200 M85K probably damaging Het
Pirb A C 7: 3,716,599 I516S possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Pum2 T A 12: 8,744,706 I737N probably damaging Het
Recql5 A T 11: 115,927,389 C159S probably damaging Het
Rxrg A G 1: 167,625,004 N125S probably benign Het
Sgip1 C A 4: 102,966,280 N699K probably damaging Het
Shprh G A 10: 11,170,297 probably null Het
Smcp C T 3: 92,584,147 G131D unknown Het
St8sia6 A G 2: 13,793,377 L23P possibly damaging Het
Stk32c T A 7: 139,119,360 T335S probably benign Het
Stox1 G A 10: 62,664,033 A916V possibly damaging Het
Syk A T 13: 52,631,717 T297S probably benign Het
Tert G T 13: 73,648,371 A1074S probably benign Het
Tex9 A T 9: 72,477,905 D135E probably damaging Het
Tmem132a G A 19: 10,864,007 H318Y possibly damaging Het
Ttn A G 2: 76,907,905 S4097P probably benign Het
Ush2a A T 1: 188,821,677 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vsig8 A G 1: 172,560,677 S71G probably benign Het
Zfp318 G A 17: 46,386,736 D173N probably damaging Het
Zfp638 T A 6: 83,962,094 S936T probably damaging Het
Zic2 A G 14: 122,476,316 Y214C probably damaging Het
Other mutations in Mycbpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Mycbpap APN 11 94509319 unclassified probably null
IGL01372:Mycbpap APN 11 94506456 missense possibly damaging 0.56
IGL01627:Mycbpap APN 11 94514604 missense probably damaging 0.98
IGL01645:Mycbpap APN 11 94503467 splice site probably null
IGL01712:Mycbpap APN 11 94512655 missense possibly damaging 0.50
IGL02209:Mycbpap APN 11 94509882 splice site probably benign
IGL02377:Mycbpap APN 11 94503250 missense probably damaging 1.00
IGL03088:Mycbpap APN 11 94513943 critical splice acceptor site probably null
IGL03412:Mycbpap APN 11 94508101 splice site probably null
IGL03046:Mycbpap UTSW 11 94505717 missense possibly damaging 0.84
P0008:Mycbpap UTSW 11 94504067 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0437:Mycbpap UTSW 11 94513512 splice site probably benign
R0706:Mycbpap UTSW 11 94513786 nonsense probably null
R0791:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1496:Mycbpap UTSW 11 94505561 missense probably benign 0.11
R1522:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1698:Mycbpap UTSW 11 94508143 nonsense probably null
R1796:Mycbpap UTSW 11 94507551 missense probably damaging 1.00
R1906:Mycbpap UTSW 11 94505621 missense probably benign 0.24
R4115:Mycbpap UTSW 11 94512225 splice site probably null
R4930:Mycbpap UTSW 11 94503157 missense probably benign 0.20
R4965:Mycbpap UTSW 11 94504938 missense probably damaging 1.00
R5326:Mycbpap UTSW 11 94507746 splice site probably null
R5542:Mycbpap UTSW 11 94507746 splice site probably null
R5625:Mycbpap UTSW 11 94505693 missense probably damaging 0.99
R5841:Mycbpap UTSW 11 94505610 missense probably damaging 1.00
R5996:Mycbpap UTSW 11 94513594 missense probably benign
R6065:Mycbpap UTSW 11 94508187 unclassified probably null
R6192:Mycbpap UTSW 11 94507731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTCAATGGCTCCTAAGG -3'
(R):5'- AGGGATTCTCTTAAAGCGTCTGAG -3'

Sequencing Primer
(F):5'- CCTAAGGGAGGTCTGATGCTCTC -3'
(R):5'- CTCTTAAAGCGTCTGAGAACAAG -3'
Posted On2016-07-22