Incidental Mutation 'R5323:Ahnak2'
ID404983
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission 042906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5323 (G1)
Quality Score143
Status Not validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 112779812 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101010] [ENSMUST00000124526] [ENSMUST00000128258]
Predicted Effect probably benign
Transcript: ENSMUST00000101010
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124526
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137195
AA Change: M400K
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812
AA Change: M400K

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,557,061 C784S probably damaging Het
Apon A G 10: 128,255,038 E195G probably damaging Het
Atxn10 A G 15: 85,391,743 I334V probably benign Het
Camsap1 G T 2: 25,965,811 A145E probably damaging Het
Capns1 G T 7: 30,187,722 F243L possibly damaging Het
Catsper2 A T 2: 121,406,735 I228N probably damaging Het
Ceacam14 A T 7: 17,815,477 *264C probably null Het
Cel A C 2: 28,560,518 V165G probably damaging Het
Cldnd1 T A 16: 58,729,653 D66E possibly damaging Het
Cntnap5b T A 1: 100,383,550 C589* probably null Het
Dnah3 T A 7: 120,021,011 H1554L probably damaging Het
Fbxw25 T A 9: 109,663,505 M55L probably benign Het
Fn1 T C 1: 71,597,432 H2187R probably benign Het
Fsip2 A G 2: 82,988,145 T4741A possibly damaging Het
Gabpa T A 16: 84,857,046 I272N possibly damaging Het
Ganab T C 19: 8,908,685 S212P probably benign Het
Ggt1 A G 10: 75,585,661 probably null Het
Hpgds T C 6: 65,132,185 T81A probably benign Het
Insr G A 8: 3,202,902 T419I probably benign Het
Itgb7 A G 15: 102,231,624 probably benign Het
Kcnt1 A G 2: 25,909,277 I951V possibly damaging Het
Lrrc4c T A 2: 97,630,153 C375S probably damaging Het
Muc3 G T 5: 137,146,689 C44* probably null Het
Mycbpap A T 11: 94,503,504 D313E probably benign Het
Neo1 A G 9: 58,906,648 probably null Het
Ntsr2 C T 12: 16,659,933 S405F probably benign Het
Nup153 G A 13: 46,717,206 P21S probably benign Het
Obscn T A 11: 58,996,877 E7705D probably benign Het
Ogn A G 13: 49,609,341 D53G probably benign Het
Olfr116 A T 17: 37,624,155 I160K probably benign Het
Olfr1505 A T 19: 13,919,616 I199F possibly damaging Het
Olfr175-ps1 G A 16: 58,824,703 T2I probably benign Het
Olfr467 T C 7: 107,814,676 F33L possibly damaging Het
Olfr976 A T 9: 39,956,829 Y35* probably null Het
Pde6a G A 18: 61,232,911 R236H possibly damaging Het
Pigk T A 3: 152,738,200 M85K probably damaging Het
Pirb A C 7: 3,716,599 I516S possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Pum2 T A 12: 8,744,706 I737N probably damaging Het
Recql5 A T 11: 115,927,389 C159S probably damaging Het
Rxrg A G 1: 167,625,004 N125S probably benign Het
Sgip1 C A 4: 102,966,280 N699K probably damaging Het
Shprh G A 10: 11,170,297 probably null Het
Smcp C T 3: 92,584,147 G131D unknown Het
St8sia6 A G 2: 13,793,377 L23P possibly damaging Het
Stk32c T A 7: 139,119,360 T335S probably benign Het
Stox1 G A 10: 62,664,033 A916V possibly damaging Het
Syk A T 13: 52,631,717 T297S probably benign Het
Tert G T 13: 73,648,371 A1074S probably benign Het
Tex9 A T 9: 72,477,905 D135E probably damaging Het
Tmem132a G A 19: 10,864,007 H318Y possibly damaging Het
Ttn A G 2: 76,907,905 S4097P probably benign Het
Ush2a A T 1: 188,821,677 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vsig8 A G 1: 172,560,677 S71G probably benign Het
Zfp318 G A 17: 46,386,736 D173N probably damaging Het
Zfp638 T A 6: 83,962,094 S936T probably damaging Het
Zic2 A G 14: 122,476,316 Y214C probably damaging Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
Predicted Primers PCR Primer
(F):5'- AACTTGCTGTCTTTGGCCG -3'
(R):5'- AGATGCCCGAGTTCAAGATG -3'

Sequencing Primer
(F):5'- TGTCTTTGGCCGCCACG -3'
(R):5'- CCGAGTTCAAGATGCCCTC -3'
Posted On2016-07-22