Incidental Mutation 'R5323:Zic2'
ID 404989
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Name zinc finger protein of the cerebellum 2
Synonyms odd-paired homolog, GENA 29, Ku
MMRRC Submission 042906-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.899) question?
Stock # R5323 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 122712847-122717264 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122713728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 214 (Y214C)
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075888
AA Change: Y214C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: Y214C

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,206,269 (GRCm39) C784S probably damaging Het
Ahnak2 A T 12: 112,745,989 (GRCm39) probably benign Het
Apon A G 10: 128,090,907 (GRCm39) E195G probably damaging Het
Atxn10 A G 15: 85,275,944 (GRCm39) I334V probably benign Het
Camsap1 G T 2: 25,855,823 (GRCm39) A145E probably damaging Het
Capns1 G T 7: 29,887,147 (GRCm39) F243L possibly damaging Het
Catsper2 A T 2: 121,237,216 (GRCm39) I228N probably damaging Het
Ceacam14 A T 7: 17,549,402 (GRCm39) *264C probably null Het
Cel A C 2: 28,450,530 (GRCm39) V165G probably damaging Het
Cldnd1 T A 16: 58,550,016 (GRCm39) D66E possibly damaging Het
Cntnap5b T A 1: 100,311,275 (GRCm39) C589* probably null Het
Dnah3 T A 7: 119,620,234 (GRCm39) H1554L probably damaging Het
Fbxw25 T A 9: 109,492,573 (GRCm39) M55L probably benign Het
Fn1 T C 1: 71,636,591 (GRCm39) H2187R probably benign Het
Fsip2 A G 2: 82,818,489 (GRCm39) T4741A possibly damaging Het
Gabpa T A 16: 84,653,934 (GRCm39) I272N possibly damaging Het
Ganab T C 19: 8,886,049 (GRCm39) S212P probably benign Het
Ggt1 A G 10: 75,421,495 (GRCm39) probably null Het
Hpgds T C 6: 65,109,169 (GRCm39) T81A probably benign Het
Insr G A 8: 3,252,902 (GRCm39) T419I probably benign Het
Itgb7 A G 15: 102,140,059 (GRCm39) probably benign Het
Kcnt1 A G 2: 25,799,289 (GRCm39) I951V possibly damaging Het
Lrrc4c T A 2: 97,460,498 (GRCm39) C375S probably damaging Het
Muc17 G T 5: 137,175,537 (GRCm39) C44* probably null Het
Mycbpap A T 11: 94,394,330 (GRCm39) D313E probably benign Het
Neo1 A G 9: 58,813,931 (GRCm39) probably null Het
Ntsr2 C T 12: 16,709,934 (GRCm39) S405F probably benign Het
Nup153 G A 13: 46,870,682 (GRCm39) P21S probably benign Het
Obscn T A 11: 58,887,703 (GRCm39) E7705D probably benign Het
Ogn A G 13: 49,762,817 (GRCm39) D53G probably benign Het
Or10d5j A T 9: 39,868,125 (GRCm39) Y35* probably null Het
Or14j10 A T 17: 37,935,046 (GRCm39) I160K probably benign Het
Or5k8 G A 16: 58,645,066 (GRCm39) T2I probably benign Het
Or5p5 T C 7: 107,413,883 (GRCm39) F33L possibly damaging Het
Or9i1b A T 19: 13,896,980 (GRCm39) I199F possibly damaging Het
Pde6a G A 18: 61,365,983 (GRCm39) R236H possibly damaging Het
Pigk T A 3: 152,443,837 (GRCm39) M85K probably damaging Het
Pirb A C 7: 3,719,598 (GRCm39) I516S possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Pum2 T A 12: 8,794,706 (GRCm39) I737N probably damaging Het
Recql5 A T 11: 115,818,215 (GRCm39) C159S probably damaging Het
Rxrg A G 1: 167,452,573 (GRCm39) N125S probably benign Het
Sgip1 C A 4: 102,823,477 (GRCm39) N699K probably damaging Het
Shprh G A 10: 11,046,041 (GRCm39) probably null Het
Smcp C T 3: 92,491,454 (GRCm39) G131D unknown Het
St8sia6 A G 2: 13,798,188 (GRCm39) L23P possibly damaging Het
Stk32c T A 7: 138,699,276 (GRCm39) T335S probably benign Het
Stox1 G A 10: 62,499,812 (GRCm39) A916V possibly damaging Het
Syk A T 13: 52,785,753 (GRCm39) T297S probably benign Het
Tert G T 13: 73,796,490 (GRCm39) A1074S probably benign Het
Tex9 A T 9: 72,385,187 (GRCm39) D135E probably damaging Het
Tmem132a G A 19: 10,841,371 (GRCm39) H318Y possibly damaging Het
Ttn A G 2: 76,738,249 (GRCm39) S4097P probably benign Het
Ush2a A T 1: 188,553,874 (GRCm39) probably null Het
Usp36 A T 11: 118,156,020 (GRCm39) S586T probably benign Het
Vsig8 A G 1: 172,388,244 (GRCm39) S71G probably benign Het
Zfp318 G A 17: 46,697,662 (GRCm39) D173N probably damaging Het
Zfp638 T A 6: 83,939,076 (GRCm39) S936T probably damaging Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122,715,971 (GRCm39) nonsense probably null
IGL01607:Zic2 APN 14 122,716,294 (GRCm39) splice site probably benign
IGL02307:Zic2 APN 14 122,714,046 (GRCm39) missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122,713,606 (GRCm39) missense probably damaging 0.99
IGL02561:Zic2 APN 14 122,715,957 (GRCm39) nonsense probably null
IGL02982:Zic2 APN 14 122,715,979 (GRCm39) missense probably damaging 0.98
R0001:Zic2 UTSW 14 122,716,369 (GRCm39) missense probably damaging 0.99
R0027:Zic2 UTSW 14 122,713,755 (GRCm39) missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122,713,953 (GRCm39) missense probably damaging 0.96
R0310:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0418:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0420:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0421:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0518:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0520:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0521:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0628:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R1733:Zic2 UTSW 14 122,716,359 (GRCm39) missense probably damaging 0.97
R1757:Zic2 UTSW 14 122,716,031 (GRCm39) missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122,716,329 (GRCm39) nonsense probably null
R5381:Zic2 UTSW 14 122,713,227 (GRCm39) missense probably damaging 0.97
R6930:Zic2 UTSW 14 122,713,869 (GRCm39) missense probably damaging 0.99
R7223:Zic2 UTSW 14 122,713,503 (GRCm39) missense probably damaging 0.98
R8750:Zic2 UTSW 14 122,714,129 (GRCm39) missense probably benign 0.06
R8852:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
R8860:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
Z1088:Zic2 UTSW 14 122,716,087 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACGTTGGCTCCTATTCGG -3'
(R):5'- TCGTGCATGGTGCTGAAAG -3'

Sequencing Primer
(F):5'- GGACTTCCTGTTCCGCAG -3'
(R):5'- TGCTGAAAGTTTTGTTGCAGC -3'
Posted On 2016-07-22