Incidental Mutation 'R5324:Gm4787'
ID405030
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5324 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 81377830 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 518 (T518S)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: T518S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: T518S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Pabpc1 A G 15: 36,600,625 F314L probably damaging Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCTTGACACCATCACAGTG -3'
(R):5'- CTCAGGGCAGCTCTTGTAATAAAG -3'

Sequencing Primer
(F):5'- CCATCACAGTGGAGCATTCC -3'
(R):5'- CAGCTCTTGTAATAAAGGAGGTTGC -3'
Posted On2016-07-22