Incidental Mutation 'R5324:Pabpc1'
ID405032
Institutional Source Beutler Lab
Gene Symbol Pabpc1
Ensembl Gene ENSMUSG00000022283
Gene Namepoly(A) binding protein, cytoplasmic 1
SynonymsPabp1, Pabpl1
MMRRC Submission 042907-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R5324 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location36595661-36609668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36600625 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 314 (F314L)
Ref Sequence ENSEMBL: ENSMUSP00000001809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001809]
Predicted Effect probably damaging
Transcript: ENSMUST00000001809
AA Change: F314L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001809
Gene: ENSMUSG00000022283
AA Change: F314L

DomainStartEndE-ValueType
RRM 12 85 6.86e-22 SMART
RRM 100 171 2.72e-25 SMART
RRM 192 264 5.39e-29 SMART
RRM 295 366 5.83e-25 SMART
low complexity region 455 462 N/A INTRINSIC
low complexity region 492 509 N/A INTRINSIC
PolyA 554 617 6.9e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147116
Predicted Effect probably benign
Transcript: ENSMUST00000155116
SMART Domains Protein: ENSMUSP00000117063
Gene: ENSMUSG00000022283

DomainStartEndE-ValueType
PolyA 36 99 6.9e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226867
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,907 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ap5b1 G A 19: 5,569,835 E428K possibly damaging Het
Bmp2 C T 2: 133,561,359 R277* probably null Het
Cbl A T 9: 44,154,254 S659T probably damaging Het
Col14a1 A T 15: 55,338,445 H43L unknown Het
Corin A G 5: 72,435,257 C133R probably damaging Het
Cyp1a1 A G 9: 57,702,369 N401S probably benign Het
Dip2a T C 10: 76,296,393 D508G probably damaging Het
Dnah2 T A 11: 69,457,993 H2556L probably benign Het
Dock8 T C 19: 25,163,094 F1333L probably benign Het
Epg5 A G 18: 77,962,445 K717E possibly damaging Het
Fmn2 G A 1: 174,608,880 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hbp1 T C 12: 31,928,618 N510S probably damaging Het
Lrguk T C 6: 34,073,797 S397P possibly damaging Het
Mmrn1 A T 6: 60,976,586 D617V probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
N6amt1 A G 16: 87,354,353 D34G probably damaging Het
Nktr A T 9: 121,727,346 D30V probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr598 T A 7: 103,329,050 M188K probably damaging Het
Olfr805 T A 10: 129,722,945 I200L probably benign Het
Papln G A 12: 83,774,571 V226M probably damaging Het
Parp12 A T 6: 39,102,612 D321E probably damaging Het
Plch2 T A 4: 154,984,534 T1107S probably benign Het
Psma2 T C 13: 14,625,217 L182P probably damaging Het
Rcl1 A G 19: 29,128,001 Y196C probably benign Het
Rdh16 G A 10: 127,801,267 V24M probably damaging Het
Rpe65 A G 3: 159,604,404 T105A possibly damaging Het
Serpini1 T C 3: 75,640,294 I371T probably damaging Het
Tet2 T C 3: 133,485,913 N920S probably benign Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmprss11f T A 5: 86,556,978 D27V possibly damaging Het
Zxdc T A 6: 90,373,800 I411N probably damaging Het
Other mutations in Pabpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01602:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01605:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01973:Pabpc1 APN 15 36599275 missense probably benign 0.13
R0309:Pabpc1 UTSW 15 36597493 missense possibly damaging 0.93
R0667:Pabpc1 UTSW 15 36598031 missense probably benign
R0883:Pabpc1 UTSW 15 36599054 unclassified probably benign
R1682:Pabpc1 UTSW 15 36605541 missense possibly damaging 0.75
R1749:Pabpc1 UTSW 15 36608340 missense probably damaging 1.00
R4731:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4732:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4733:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4825:Pabpc1 UTSW 15 36597011 missense probably damaging 0.98
R5328:Pabpc1 UTSW 15 36602877 missense probably benign 0.03
R5711:Pabpc1 UTSW 15 36605830 missense probably benign 0.03
R6073:Pabpc1 UTSW 15 36600651 missense probably damaging 0.97
R6751:Pabpc1 UTSW 15 36597534 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGCAATCTGACTCCCAAGG -3'
(R):5'- ACTTCCAGGTAACAGGTTGGG -3'

Sequencing Primer
(F):5'- AAATAGGATCTTTTCTACTTGGGGG -3'
(R):5'- CAGGTAACAGGTTGGGAGGGAAG -3'
Posted On2016-07-22