Incidental Mutation 'R5189:Plin2'
ID 405049
Institutional Source Beutler Lab
Gene Symbol Plin2
Ensembl Gene ENSMUSG00000028494
Gene Name perilipin 2
Synonyms Adrp, ADPH, adipophilin, Adfp
MMRRC Submission 042767-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R5189 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 86566623-86588297 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86575383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 389 (Y389H)
Ref Sequence ENSEMBL: ENSMUSP00000000466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000466] [ENSMUST00000140382] [ENSMUST00000147097] [ENSMUST00000149700]
AlphaFold P43883
Predicted Effect probably damaging
Transcript: ENSMUST00000000466
AA Change: Y389H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000466
Gene: ENSMUSG00000028494
AA Change: Y389H

DomainStartEndE-ValueType
Pfam:Perilipin 6 393 5.3e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138605
Predicted Effect probably benign
Transcript: ENSMUST00000140382
SMART Domains Protein: ENSMUSP00000123456
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147097
SMART Domains Protein: ENSMUSP00000119063
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 157 3.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149700
SMART Domains Protein: ENSMUSP00000123333
Gene: ENSMUSG00000028494

DomainStartEndE-ValueType
Pfam:Perilipin 1 196 5.2e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154999
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the perilipin family, members of which coat intracellular lipid storage droplets. This protein is associated with the lipid globule surface membrane material, and maybe involved in development and maintenance of adipose tissue. However, it is not restricted to adipocytes as previously thought, but is found in a wide range of cultured cell lines, including fibroblasts, endothelial and epithelial cells, and tissues, such as lactating mammary gland, adrenal cortex, Sertoli and Leydig cells, and hepatocytes in alcoholic liver cirrhosis, suggesting that it may serve as a marker of lipid accumulation in diverse cell types and diseases. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for null mutations are resistant to diet-induced obesity and hepatic steatosis and may exhibit altered milk composition, vision abnormalities, or small sebaceous glands. Male mice homozygous for a gene trap allele are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik C T 12: 71,240,123 (GRCm39) T1311I possibly damaging Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
4930505A04Rik T C 11: 30,376,169 (GRCm39) T233A probably damaging Het
Ankar T C 1: 72,697,573 (GRCm39) I859V probably benign Het
Cacnb2 G T 2: 14,990,849 (GRCm39) A644S possibly damaging Het
Gatb T C 3: 85,544,238 (GRCm39) V402A probably benign Het
Gpcpd1 T C 2: 132,395,892 (GRCm39) K153R probably damaging Het
Hip1 A G 5: 135,463,147 (GRCm39) L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,998,060 (GRCm39) probably null Het
Hydin A T 8: 111,139,843 (GRCm39) probably null Het
Igsf3 A T 3: 101,338,843 (GRCm39) T386S possibly damaging Het
Il12rb1 A G 8: 71,263,702 (GRCm39) T88A possibly damaging Het
Kank1 T C 19: 25,401,545 (GRCm39) S1051P probably damaging Het
Kap A G 6: 133,828,879 (GRCm39) probably null Het
Ly96 A G 1: 16,771,091 (GRCm39) E74G probably damaging Het
Map7d1 G T 4: 126,136,097 (GRCm39) probably null Het
Megf6 G T 4: 154,336,980 (GRCm39) R253L probably benign Het
Mex3b A G 7: 82,518,459 (GRCm39) D258G probably damaging Het
Mpzl3 T C 9: 44,973,408 (GRCm39) I49T possibly damaging Het
Myh15 C A 16: 48,921,870 (GRCm39) T472N probably benign Het
Nacad A G 11: 6,551,611 (GRCm39) S527P probably damaging Het
Nkx2-3 T G 19: 43,601,147 (GRCm39) S70A probably benign Het
Nkx2-6 A T 14: 69,409,342 (GRCm39) Q31L probably benign Het
Or6ae1 A G 7: 139,742,632 (GRCm39) V77A probably damaging Het
Pcdha6 A T 18: 37,101,844 (GRCm39) N346Y probably damaging Het
Pkd2 G A 5: 104,607,785 (GRCm39) D95N probably benign Het
Pkhd1l1 A G 15: 44,410,544 (GRCm39) T2684A probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Slc41a2 T C 10: 83,149,275 (GRCm39) probably null Het
Smg6 A G 11: 74,932,822 (GRCm39) T1038A probably damaging Het
Suds3 T C 5: 117,238,664 (GRCm39) probably benign Het
Tbc1d8 T C 1: 39,424,213 (GRCm39) H626R probably benign Het
Tmem260 T A 14: 48,746,573 (GRCm39) H616Q probably benign Het
Trip10 A T 17: 57,568,288 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubr4 A G 4: 139,137,960 (GRCm39) T1106A probably benign Het
Vmn1r84 A T 7: 12,096,385 (GRCm39) S103T probably benign Het
Vps13a G T 19: 16,662,679 (GRCm39) P1602Q probably damaging Het
Other mutations in Plin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Plin2 APN 4 86,582,683 (GRCm39) missense possibly damaging 0.88
IGL02501:Plin2 APN 4 86,582,723 (GRCm39) nonsense probably null
IGL02551:Plin2 APN 4 86,576,929 (GRCm39) missense probably benign 0.00
IGL03294:Plin2 APN 4 86,580,315 (GRCm39) missense probably damaging 0.96
R1484:Plin2 UTSW 4 86,575,481 (GRCm39) missense probably benign 0.00
R2165:Plin2 UTSW 4 86,586,669 (GRCm39) missense probably damaging 1.00
R2870:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2870:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2871:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2872:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R2873:Plin2 UTSW 4 86,586,915 (GRCm39) start codon destroyed probably null 0.99
R3125:Plin2 UTSW 4 86,575,381 (GRCm39) nonsense probably null
R4948:Plin2 UTSW 4 86,580,228 (GRCm39) missense probably benign 0.00
R5563:Plin2 UTSW 4 86,580,341 (GRCm39) missense probably benign 0.01
R6229:Plin2 UTSW 4 86,586,903 (GRCm39) missense probably benign
R6258:Plin2 UTSW 4 86,575,526 (GRCm39) missense probably damaging 0.97
R6260:Plin2 UTSW 4 86,575,526 (GRCm39) missense probably damaging 0.97
R6391:Plin2 UTSW 4 86,580,236 (GRCm39) missense probably null 0.99
R6470:Plin2 UTSW 4 86,586,607 (GRCm39) missense probably damaging 1.00
R6493:Plin2 UTSW 4 86,580,224 (GRCm39) missense possibly damaging 0.80
R6562:Plin2 UTSW 4 86,576,832 (GRCm39) missense probably benign 0.07
R6706:Plin2 UTSW 4 86,578,357 (GRCm39) missense probably benign 0.02
R7310:Plin2 UTSW 4 86,586,628 (GRCm39) missense probably benign 0.03
R8057:Plin2 UTSW 4 86,575,638 (GRCm39) missense possibly damaging 0.80
R8171:Plin2 UTSW 4 86,575,349 (GRCm39) missense probably damaging 0.99
R9003:Plin2 UTSW 4 86,580,324 (GRCm39) missense probably benign 0.08
R9041:Plin2 UTSW 4 86,578,504 (GRCm39) missense probably benign
R9789:Plin2 UTSW 4 86,576,914 (GRCm39) missense probably damaging 1.00
R9800:Plin2 UTSW 4 86,586,742 (GRCm39) missense possibly damaging 0.78
U24488:Plin2 UTSW 4 86,580,314 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCTTGGTTCTAAGAAGC -3'
(R):5'- AGGGTTACCACAGAACATTCAAG -3'

Sequencing Primer
(F):5'- GGTTCTAAGAAGCTGCTTTTCTAAGC -3'
(R):5'- TTCAAGATCAGGCCAAACACTTG -3'
Posted On 2016-07-22