Incidental Mutation 'R0497:Sema4c'
ID40510
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
SynonymsSemaf, Semacl1, M-Sema F, Semacl1, Semai
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0497 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36548639-36558349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36549608 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 812 (D812E)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000194894] [ENSMUST00000195620] [ENSMUST00000207843]
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114990
AA Change: D812E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110641
Gene: ENSMUSG00000026121
AA Change: D812E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114991
AA Change: D812E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: D812E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191642
AA Change: D812E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: D812E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191677
AA Change: D812E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: D812E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably benign
Transcript: ENSMUST00000194894
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably benign
Transcript: ENSMUST00000195620
AA Change: D812E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: D812E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208690
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36553920 critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36553029 missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36553085 missense probably damaging 1.00
IGL02262:Sema4c APN 1 36550341 missense probably damaging 1.00
IGL02282:Sema4c APN 1 36550203 unclassified probably null
IGL02476:Sema4c APN 1 36555950 missense probably damaging 0.98
IGL02900:Sema4c APN 1 36550745 nonsense probably null
swirl UTSW 1 36550311 missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36552884 missense probably damaging 1.00
R0427:Sema4c UTSW 1 36553811 nonsense probably null
R1066:Sema4c UTSW 1 36550200 missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36552110 missense probably damaging 1.00
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1639:Sema4c UTSW 1 36553534 missense probably benign 0.00
R1644:Sema4c UTSW 1 36550804 missense probably damaging 1.00
R3176:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36553723 missense probably benign 0.02
R4452:Sema4c UTSW 1 36553756 missense probably benign 0.31
R4883:Sema4c UTSW 1 36552016 missense probably damaging 0.98
R4895:Sema4c UTSW 1 36553570 splice site probably null
R4913:Sema4c UTSW 1 36550185 missense probably benign 0.11
R4944:Sema4c UTSW 1 36550311 missense probably damaging 1.00
R5062:Sema4c UTSW 1 36552978 critical splice donor site probably null
R5077:Sema4c UTSW 1 36551731 missense probably benign 0.20
R5109:Sema4c UTSW 1 36552300 frame shift probably null
R5208:Sema4c UTSW 1 36550326 missense probably damaging 1.00
R5551:Sema4c UTSW 1 36552317 missense probably damaging 1.00
R5912:Sema4c UTSW 1 36554388 missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36550753 missense probably benign 0.02
R7111:Sema4c UTSW 1 36553079 missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36553020 missense probably damaging 0.99
R7252:Sema4c UTSW 1 36550015 missense probably damaging 1.00
X0019:Sema4c UTSW 1 36552996 missense probably damaging 1.00
X0028:Sema4c UTSW 1 36549966 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTAGCTGGTGCCTGTGCAAAAG -3'
(R):5'- CTGGCCCCGAAACTGATGAGAAAC -3'

Sequencing Primer
(F):5'- CTGGTGCCTGTGCAAAAGTTAAG -3'
(R):5'- TCAAGATTGTGCCTGGTCAC -3'
Posted On2013-05-23