Mutagenetix > Incidental Mutation

Incidental Mutation 'R5192:Or1e16'

405102

Institutional Source

Beutler Lab

Gene Symbol

Or1e16

Ensembl Gene

ENSMUSG00000069823

Gene Name

olfactory receptor family 1 subfamily E member 16

Synonyms

GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1

MMRRC Submission

042768-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.164) question?

Stock #

R5192 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

73285902-73290321 bp(-) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

AGCGGTCGTAGGC to AGC at 73286480 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]

AlphaFold

Q8VGI1

Predicted Effect

probably null
Transcript: ENSMUST00000120303

SMART Domains

Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	8.7e-60	PFAM
Pfam:7tm_1	41	290	2e-27	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000131253

SMART Domains

Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	31	184	1.2e-6	PFAM
Pfam:7TM_GPCR_Srsx	35	171	6.1e-8	PFAM
Pfam:7tm_1	41	191	3.6e-30	PFAM
Pfam:7tm_4	139	196	1.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134011

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef25	A	G	10: 127,020,978 (GRCm39)	S303P	probably damaging	Het
Babam1	T	C	8: 71,856,897 (GRCm39)	V286A	probably damaging	Het
Becn2	A	G	1: 175,748,408 (GRCm39)	D158G	probably benign	Het
Cep192	T	C	18: 67,968,075 (GRCm39)	I853T	probably benign	Het
Cfap43	A	T	19: 47,814,364 (GRCm39)	W157R	probably damaging	Het
Dnah17	T	C	11: 117,925,185 (GRCm39)	T3883A	possibly damaging	Het
Dzip1	C	T	14: 119,148,805 (GRCm39)	M291I	probably damaging	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Fbxw19	T	C	9: 109,313,496 (GRCm39)	Y234C	probably benign	Het
Gask1a	T	G	9: 121,794,727 (GRCm39)	S294A	probably benign	Het
Gm9988	T	C	8: 88,865,001 (GRCm39)		probably benign	Het
Gstm1	A	G	3: 107,922,259 (GRCm39)		probably null	Het
Hsfy2	T	A	1: 56,675,894 (GRCm39)	K214N	probably benign	Het
Kat6a	G	A	8: 23,401,729 (GRCm39)	R366H	probably damaging	Het
Kctd4	A	G	14: 76,200,127 (GRCm39)	T33A	probably benign	Het
Klrh1	T	C	6: 129,748,721 (GRCm39)	T99A	probably benign	Het
Marchf10	T	C	11: 105,262,752 (GRCm39)	H735R	possibly damaging	Het
Myo1g	T	C	11: 6,464,816 (GRCm39)	D486G	probably damaging	Het
Or5d46	A	G	2: 88,170,092 (GRCm39)	Y61C	possibly damaging	Het
Or8b1	T	C	9: 38,400,101 (GRCm39)	Y259H	possibly damaging	Het
Pif1	G	T	9: 65,495,374 (GRCm39)	A95S	probably benign	Het
Plppr2	T	C	9: 21,852,428 (GRCm39)	F104S	probably damaging	Het
Prep	T	C	10: 45,029,207 (GRCm39)	Y536H	probably benign	Het
Slc22a30	G	A	19: 8,321,757 (GRCm39)	Q436*	probably null	Het
Tmtc2	G	A	10: 105,026,038 (GRCm39)	P810L	probably damaging	Het
Tollip	C	T	7: 141,445,854 (GRCm39)	R9H	probably damaging	Het
Vmn2r57	A	T	7: 41,077,363 (GRCm39)	S268T	probably damaging	Het
Vps51	A	G	19: 6,120,497 (GRCm39)	V472A	possibly damaging	Het
Zfp608	C	A	18: 55,031,569 (GRCm39)	K790N	probably damaging	Het
Zfp661	A	G	2: 127,418,982 (GRCm39)	V386A	possibly damaging	Het

Other mutations in Or1e16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Or1e16	APN	11	73,286,017 (GRCm39)	missense	probably damaging	0.98
IGL01938:Or1e16	APN	11	73,286,471 (GRCm39)	missense	probably damaging	1.00
IGL02270:Or1e16	APN	11	73,286,191 (GRCm39)	missense	probably benign
IGL03287:Or1e16	APN	11	73,286,845 (GRCm39)	start codon destroyed	probably null	1.00
R0006:Or1e16	UTSW	11	73,286,314 (GRCm39)	missense	probably damaging	0.99
R0907:Or1e16	UTSW	11	73,285,945 (GRCm39)	missense	probably damaging	0.97
R1982:Or1e16	UTSW	11	73,285,918 (GRCm39)	missense	probably benign	0.00
R3804:Or1e16	UTSW	11	73,286,776 (GRCm39)	missense	probably benign	0.01
R4064:Or1e16	UTSW	11	73,286,348 (GRCm39)	missense	probably benign	0.04
R4171:Or1e16	UTSW	11	73,286,365 (GRCm39)	missense	probably damaging	1.00
R4724:Or1e16	UTSW	11	73,285,981 (GRCm39)	missense	probably damaging	1.00
R4732:Or1e16	UTSW	11	73,286,521 (GRCm39)	missense	probably benign	0.03
R4733:Or1e16	UTSW	11	73,286,521 (GRCm39)	missense	probably benign	0.03
R5030:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5097:Or1e16	UTSW	11	73,286,119 (GRCm39)	missense	probably damaging	1.00
R5098:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5101:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5135:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5137:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5193:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5193:Or1e16	UTSW	11	73,286,479 (GRCm39)	frame shift	probably null
R5197:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5220:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5221:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5222:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5258:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5297:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5396:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5398:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5399:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5432:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5433:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5531:Or1e16	UTSW	11	73,286,003 (GRCm39)	missense	probably benign	0.26
R5634:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5714:Or1e16	UTSW	11	73,286,187 (GRCm39)	splice site	probably null
R5812:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5813:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5814:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5815:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5913:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5955:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5956:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R5968:Or1e16	UTSW	11	73,286,018 (GRCm39)	missense	possibly damaging	0.75
R6029:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R6034:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R6034:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R6176:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R6177:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R6178:Or1e16	UTSW	11	73,286,480 (GRCm39)	frame shift	probably null
R6196:Or1e16	UTSW	11	73,286,299 (GRCm39)	missense	probably benign	0.08
R6995:Or1e16	UTSW	11	73,286,410 (GRCm39)	missense	probably benign
R7035:Or1e16	UTSW	11	73,286,544 (GRCm39)	missense	probably benign	0.00
R7470:Or1e16	UTSW	11	73,286,714 (GRCm39)	missense	probably damaging	1.00
R7530:Or1e16	UTSW	11	73,279,189 (GRCm39)	missense	possibly damaging	0.55
R8461:Or1e16	UTSW	11	73,285,982 (GRCm39)	missense	probably damaging	1.00
R9149:Or1e16	UTSW	11	73,286,853 (GRCm39)	unclassified	probably benign
R9279:Or1e16	UTSW	11	73,279,789 (GRCm39)	missense	probably benign	0.05
R9293:Or1e16	UTSW	11	73,285,955 (GRCm39)	missense	probably damaging	0.99
R9682:Or1e16	UTSW	11	73,286,025 (GRCm39)	missense	probably benign	0.03
R9752:Or1e16	UTSW	11	73,286,479 (GRCm39)	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATTAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'

Posted On

2016-07-22