Incidental Mutation 'R5291:Scarf1'
ID405160
Institutional Source Beutler Lab
Gene Symbol Scarf1
Ensembl Gene ENSMUSG00000038188
Gene Namescavenger receptor class F, member 1
SynonymsSREC-I, SREC
MMRRC Submission 042874-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5291 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75513540-75526582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75524074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 525 (S525P)
Ref Sequence ENSEMBL: ENSMUSP00000044248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042808] [ENSMUST00000118243] [ENSMUST00000123819]
Predicted Effect probably damaging
Transcript: ENSMUST00000042808
AA Change: S525P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188
AA Change: S525P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scavenger receptor that is expressed in endothelial cells. It regulates the uptake of chemically modified low density lipoproteins, including acetylated low density lipoprotein (Ac-LDL), and it may be involved in atherogenesis. This gene is regulated by the transcription factors ZNF444/EZF-2 and SP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no abnormalities detected in plasma glucose, cholesterol, or triglycerides, or in the brain, lung, heart, kidney, liver, or testes. Mice homozygous for a targeted allele exhibit impaired clearance of apoptotic cells and autoimmune disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,585,937 S328G probably damaging Het
Acot5 T G 12: 84,073,519 L216R probably benign Het
Ankrd6 A G 4: 32,823,446 L192P probably damaging Het
Atp6v1e1 C A 6: 120,818,333 probably null Het
Bbs9 T C 9: 22,628,997 Y358H probably damaging Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Camk2a A G 18: 60,957,164 K192R probably damaging Het
Ceacam1 T A 7: 25,471,831 R223W probably damaging Het
Cntn6 T A 6: 104,726,135 F173I probably damaging Het
Cntrl A C 2: 35,134,060 I33L probably damaging Het
Crybg2 T C 4: 134,073,427 S633P probably benign Het
Cyp2j13 T C 4: 96,068,329 H181R probably damaging Het
Dlgap1 A G 17: 70,718,210 S542G probably benign Het
Dnm2 T G 9: 21,478,907 L402R probably damaging Het
Fndc3b C A 3: 27,642,995 V23L probably benign Het
Gata4 A C 14: 63,240,599 F184V probably damaging Het
Gcnt2 A G 13: 40,918,792 R304G probably damaging Het
Gm10563 TTTC TTTCCTTC 4: 155,614,512 probably benign Het
Gm26558 G A 2: 70,661,529 probably benign Het
Grip1 G A 10: 120,086,969 V1107I probably benign Het
Herpud2 C T 9: 25,124,960 G135S probably benign Het
Lrp1 A G 10: 127,593,878 I441T probably damaging Het
Lrp1b T C 2: 40,903,003 D2553G probably damaging Het
Mkln1 T A 6: 31,490,481 N43K possibly damaging Het
Olfr1259 A T 2: 89,943,436 Y226* probably null Het
Olfr181 T C 16: 58,926,401 T57A possibly damaging Het
Paxbp1 C T 16: 91,044,352 M1I probably null Het
Phip A G 9: 82,945,883 Y97H probably damaging Het
Plec T A 15: 76,174,011 I3774F probably damaging Het
Pramef6 G T 4: 143,895,667 P373T probably damaging Het
Prrc2c C A 1: 162,705,582 probably benign Het
Prss12 T C 3: 123,505,463 L628P probably damaging Het
Ptpre G A 7: 135,678,301 V578I probably benign Het
Qsox2 A T 2: 26,217,698 L261H probably damaging Het
Rapgef2 A T 3: 79,070,059 V1327E possibly damaging Het
Rnf216 A G 5: 143,090,212 S306P probably benign Het
Rtel1 A G 2: 181,352,095 Q640R possibly damaging Het
Ryr1 T A 7: 29,115,598 D175V probably benign Het
Senp7 T A 16: 56,186,179 Y982* probably null Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Sned1 A G 1: 93,295,724 K1375E possibly damaging Het
Spats2 G T 15: 99,178,541 A167S probably benign Het
Spen C A 4: 141,488,079 A481S unknown Het
Spred3 T A 7: 29,167,830 H47L probably damaging Het
Srsf4 T A 4: 131,886,306 probably benign Het
Tdrd3 A T 14: 87,505,798 H394L probably benign Het
Terf1 A G 1: 15,819,086 probably null Het
Txlnb A T 10: 17,799,396 D99V possibly damaging Het
Ugt1a7c A T 1: 88,095,509 N130I possibly damaging Het
Vmn2r50 T A 7: 10,047,825 D331V probably damaging Het
Vps13d A G 4: 145,062,569 I744T probably damaging Het
Ythdc1 A G 5: 86,835,688 D664G probably damaging Het
Other mutations in Scarf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scarf1 APN 11 75521957 missense probably damaging 0.98
IGL02968:Scarf1 APN 11 75524089 missense probably damaging 1.00
R0078:Scarf1 UTSW 11 75515162 splice site probably benign
R0606:Scarf1 UTSW 11 75514348 missense probably damaging 0.98
R0834:Scarf1 UTSW 11 75514403 nonsense probably null
R1715:Scarf1 UTSW 11 75524044 missense probably damaging 1.00
R2327:Scarf1 UTSW 11 75526028 missense probably damaging 1.00
R2483:Scarf1 UTSW 11 75515291 missense probably damaging 0.98
R3699:Scarf1 UTSW 11 75514369 missense probably damaging 1.00
R3831:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3832:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3833:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R4957:Scarf1 UTSW 11 75525634 missense probably benign 0.10
R4990:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R4992:Scarf1 UTSW 11 75522230 missense probably damaging 1.00
R4992:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R5330:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5331:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5537:Scarf1 UTSW 11 75525531 missense probably damaging 1.00
R5583:Scarf1 UTSW 11 75514016 missense possibly damaging 0.95
R5592:Scarf1 UTSW 11 75525687 missense probably benign 0.08
R6130:Scarf1 UTSW 11 75525739 missense probably benign
R6289:Scarf1 UTSW 11 75525416 missense possibly damaging 0.83
R6313:Scarf1 UTSW 11 75520315 missense probably benign 0.02
R6360:Scarf1 UTSW 11 75515669 missense probably damaging 1.00
R6944:Scarf1 UTSW 11 75522206 missense probably benign 0.00
R7113:Scarf1 UTSW 11 75526078 missense probably damaging 0.99
Z1088:Scarf1 UTSW 11 75525490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAGCTACCCTGGGTGAC -3'
(R):5'- GTTCACTACAAGCTCTGTGAGGAC -3'

Sequencing Primer
(F):5'- TGACAGGTAAGTGGGCACTG -3'
(R):5'- ACAGGATGTTTCTTTGTTCTGAAC -3'
Posted On2016-07-22