Mutagenetix > Incidental Mutation

Incidental Mutation 'R5292:Trim24'

405195

Institutional Source

Beutler Lab

Gene Symbol

Trim24

Ensembl Gene

ENSMUSG00000029833

Gene Name

tripartite motif-containing 24

Synonyms

D430004I05Rik, A130082H20Rik, TIF1alpha, Tif1a

MMRRC Submission

042875-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5292 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37847746-37943231 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37880539 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 146 (K146E)

Ref Sequence

ENSEMBL: ENSMUSP00000113063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]

AlphaFold

Q64127

Predicted Effect

probably benign
Transcript: ENSMUST00000031859
AA Change: K146E

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: K146E

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	2.5e-10	SMART
BBOX	158	205	2e-13	SMART
BBOX	218	259	7e-14	SMART
BBC	266	392	3e-44	SMART
low complexity region	474	491	N/A	INTRINSIC
low complexity region	501	514	N/A	INTRINSIC
low complexity region	573	598	N/A	INTRINSIC
low complexity region	686	709	N/A	INTRINSIC
low complexity region	759	774	N/A	INTRINSIC
PHD	829	872	2.1e-13	SMART
BROMO	902	1007	2.4e-40	SMART
low complexity region	1025	1033	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120238
AA Change: K76E

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: K76E

Domain	Start	End	E-Value	Type
BBOX	88	135	2e-13	SMART
BBOX	148	189	6.8e-14	SMART
BBC	196	322	3e-44	SMART
low complexity region	404	421	N/A	INTRINSIC
low complexity region	431	444	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	616	639	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
PHD	759	802	2e-13	SMART
BROMO	832	937	2.4e-40	SMART
low complexity region	955	963	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120428
AA Change: K146E

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: K146E

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
RING	52	130	5.22e-8	SMART
BBOX	158	205	6.27e-11	SMART
BBOX	218	259	2.22e-11	SMART
BBC	266	392	5.86e-42	SMART
low complexity region	539	564	N/A	INTRINSIC
low complexity region	652	675	N/A	INTRINSIC
low complexity region	725	740	N/A	INTRINSIC
PHD	795	838	3.15e-11	SMART
BROMO	868	973	3.95e-38	SMART
low complexity region	991	999	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149561

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153004

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	A	G	8: 25,354,467 (GRCm39)	V641A	possibly damaging	Het
Apob	A	T	12: 8,055,912 (GRCm39)	M1465L	probably benign	Het
Astn1	T	C	1: 158,407,933 (GRCm39)		probably null	Het
Bend7	G	A	2: 4,768,052 (GRCm39)	R336Q	probably damaging	Het
Col22a1	T	C	15: 71,842,185 (GRCm39)	Y433C	probably damaging	Het
Crtc3	T	C	7: 80,268,358 (GRCm39)	T154A	possibly damaging	Het
Dcc	T	C	18: 71,439,159 (GRCm39)	Y1241C	probably damaging	Het
Depdc1b	T	C	13: 108,510,376 (GRCm39)	V296A	probably damaging	Het
Gata3	A	G	2: 9,873,685 (GRCm39)	S270P	probably damaging	Het
Gcm1	T	C	9: 77,968,708 (GRCm39)	F136S	probably damaging	Het
Gfpt1	A	G	6: 87,053,237 (GRCm39)		probably null	Het
Gm5174	G	T	10: 86,492,562 (GRCm39)		noncoding transcript	Het
Hhipl1	A	G	12: 108,294,037 (GRCm39)	T648A	probably benign	Het
Hr	C	A	14: 70,809,432 (GRCm39)	Q1177K	probably damaging	Het
Hrnr	T	C	3: 93,239,199 (GRCm39)	S3146P	unknown	Het
Igkv10-94	C	T	6: 68,681,582 (GRCm39)	G86E	probably damaging	Het
Krt80	G	A	15: 101,250,066 (GRCm39)	R222W	probably damaging	Het
Lrch3	T	C	16: 32,796,177 (GRCm39)	Y354H	probably damaging	Het
Or10g1	A	T	14: 52,647,902 (GRCm39)	N142K	possibly damaging	Het
Or3a1b	T	A	11: 74,012,877 (GRCm39)	F254Y	probably damaging	Het
Or5w1b	T	A	2: 87,476,339 (GRCm39)	N43Y	probably damaging	Het
Osbpl7	A	G	11: 96,958,779 (GRCm39)	D932G	probably benign	Het
Pakap	T	G	4: 57,855,356 (GRCm39)	S471R	probably damaging	Het
Palmd	T	C	3: 116,717,393 (GRCm39)	E368G	probably benign	Het
Peg3	T	A	7: 6,711,259 (GRCm39)	D1321V	probably damaging	Het
Pkhd1l1	A	T	15: 44,392,962 (GRCm39)	I1766F	probably damaging	Het
Polq	A	G	16: 36,881,745 (GRCm39)	E1303G	probably damaging	Het
Ppie	A	G	4: 123,033,701 (GRCm39)	Y9H	probably damaging	Het
Ptprz1	A	G	6: 23,002,581 (GRCm39)	N1557S	probably benign	Het
Rnf40	T	C	7: 127,195,120 (GRCm39)	V411A	possibly damaging	Het
Rtn4	T	C	11: 29,657,924 (GRCm39)	F577L	probably benign	Het
Sacs	A	G	14: 61,449,432 (GRCm39)	Y3826C	probably damaging	Het
Slc32a1	A	G	2: 158,453,307 (GRCm39)	D49G	probably damaging	Het
Slc37a2	A	T	9: 37,150,453 (GRCm39)	C167*	probably null	Het
Slc5a1	G	T	5: 33,315,585 (GRCm39)	V535F	probably benign	Het
Smoc2	A	G	17: 14,556,835 (GRCm39)	K95E	probably damaging	Het
Smok3c	A	C	5: 138,063,446 (GRCm39)	Q311P	probably damaging	Het
Spink5	C	A	18: 44,139,521 (GRCm39)	P628Q	probably benign	Het
Spint4	T	C	2: 164,542,779 (GRCm39)	L124S	probably benign	Het
Stard9	A	G	2: 120,529,626 (GRCm39)	K1961R	probably benign	Het
Synpo2	C	A	3: 122,907,709 (GRCm39)	V536L	possibly damaging	Het
Usp24	A	G	4: 106,275,460 (GRCm39)	D2245G	probably benign	Het
Vars2	A	G	17: 35,971,678 (GRCm39)	S81P	probably damaging	Het
Zfp39	T	C	11: 58,791,415 (GRCm39)	T91A	probably damaging	Het
Zfp764l1	T	C	7: 126,991,659 (GRCm39)	D97G	possibly damaging	Het
Zfp936	T	A	7: 42,838,759 (GRCm39)	Y75*	probably null	Het
Zkscan5	G	T	5: 145,155,451 (GRCm39)	C374F	probably damaging	Het

Other mutations in Trim24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Trim24	APN	6	37,880,583 (GRCm39)	missense	possibly damaging	0.76
IGL01307:Trim24	APN	6	37,942,570 (GRCm39)	missense	possibly damaging	0.81
IGL01790:Trim24	APN	6	37,922,548 (GRCm39)	missense	probably benign
IGL02525:Trim24	APN	6	37,922,653 (GRCm39)	missense	probably damaging	0.99
IGL02557:Trim24	APN	6	37,942,434 (GRCm39)	critical splice acceptor site	probably null
IGL02671:Trim24	APN	6	37,937,719 (GRCm39)	missense	probably damaging	1.00
IGL02795:Trim24	APN	6	37,896,324 (GRCm39)	missense	probably damaging	1.00
IGL02877:Trim24	APN	6	37,942,581 (GRCm39)	missense	probably damaging	1.00
IGL02889:Trim24	APN	6	37,934,696 (GRCm39)	missense	probably benign	0.02
IGL02930:Trim24	APN	6	37,928,380 (GRCm39)	splice site	probably benign
IGL03076:Trim24	APN	6	37,942,567 (GRCm39)	missense	probably damaging	0.98
accomodating	UTSW	6	37,896,332 (GRCm39)	missense	probably damaging	1.00
apprehensive	UTSW	6	37,934,435 (GRCm39)	splice site	probably benign
Flexible	UTSW	6	37,880,588 (GRCm39)	critical splice donor site	probably benign
Lithe	UTSW	6	37,935,504 (GRCm39)	missense	probably damaging	1.00
Nervous	UTSW	6	37,934,664 (GRCm39)	missense	probably damaging	1.00
perturbed	UTSW	6	37,896,427 (GRCm39)	critical splice donor site	probably null
pliant	UTSW	6	37,896,426 (GRCm39)	critical splice donor site	probably null
qualmish	UTSW	6	37,880,587 (GRCm39)	critical splice donor site	probably null
Queasy	UTSW	6	37,885,240 (GRCm39)	missense	probably damaging	0.99
squeamish	UTSW	6	37,892,137 (GRCm39)	nonsense	probably null
uneasy	UTSW	6	37,933,412 (GRCm39)	critical splice donor site	probably null
PIT4651001:Trim24	UTSW	6	37,877,667 (GRCm39)	critical splice donor site	probably null
R0037:Trim24	UTSW	6	37,934,484 (GRCm39)	missense	probably damaging	1.00
R0037:Trim24	UTSW	6	37,934,484 (GRCm39)	missense	probably damaging	1.00
R0183:Trim24	UTSW	6	37,920,415 (GRCm39)	missense	possibly damaging	0.90
R0471:Trim24	UTSW	6	37,892,130 (GRCm39)	missense	possibly damaging	0.94
R0485:Trim24	UTSW	6	37,934,001 (GRCm39)	missense	probably damaging	1.00
R0606:Trim24	UTSW	6	37,848,169 (GRCm39)	missense	probably benign
R0609:Trim24	UTSW	6	37,934,718 (GRCm39)	missense	probably damaging	1.00
R0637:Trim24	UTSW	6	37,935,494 (GRCm39)	splice site	probably null
R0734:Trim24	UTSW	6	37,896,400 (GRCm39)	missense	possibly damaging	0.86
R0855:Trim24	UTSW	6	37,892,137 (GRCm39)	nonsense	probably null
R1131:Trim24	UTSW	6	37,934,717 (GRCm39)	missense	probably damaging	1.00
R1141:Trim24	UTSW	6	37,892,228 (GRCm39)	missense	probably damaging	1.00
R1159:Trim24	UTSW	6	37,933,412 (GRCm39)	critical splice donor site	probably null
R1460:Trim24	UTSW	6	37,941,761 (GRCm39)	missense	probably damaging	1.00
R1672:Trim24	UTSW	6	37,892,214 (GRCm39)	missense	probably damaging	1.00
R1868:Trim24	UTSW	6	37,928,447 (GRCm39)	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37,934,013 (GRCm39)	missense	probably damaging	0.99
R1888:Trim24	UTSW	6	37,934,013 (GRCm39)	missense	probably damaging	0.99
R1894:Trim24	UTSW	6	37,934,013 (GRCm39)	missense	probably damaging	0.99
R1913:Trim24	UTSW	6	37,934,750 (GRCm39)	missense	probably damaging	1.00
R2254:Trim24	UTSW	6	37,935,612 (GRCm39)	missense	probably benign
R2511:Trim24	UTSW	6	37,880,587 (GRCm39)	critical splice donor site	probably null
R2849:Trim24	UTSW	6	37,933,388 (GRCm39)	missense	probably damaging	0.99
R3878:Trim24	UTSW	6	37,941,708 (GRCm39)	missense	probably benign	0.14
R4084:Trim24	UTSW	6	37,892,192 (GRCm39)	missense	probably damaging	1.00
R4235:Trim24	UTSW	6	37,941,675 (GRCm39)	missense	probably damaging	1.00
R4292:Trim24	UTSW	6	37,877,627 (GRCm39)	missense	possibly damaging	0.91
R4633:Trim24	UTSW	6	37,933,371 (GRCm39)	missense	probably damaging	0.98
R4651:Trim24	UTSW	6	37,934,774 (GRCm39)	critical splice donor site	probably null
R4652:Trim24	UTSW	6	37,934,774 (GRCm39)	critical splice donor site	probably null
R4686:Trim24	UTSW	6	37,885,240 (GRCm39)	missense	probably damaging	0.99
R5000:Trim24	UTSW	6	37,935,547 (GRCm39)	missense	probably benign	0.01
R5213:Trim24	UTSW	6	37,934,010 (GRCm39)	missense	probably damaging	0.99
R5258:Trim24	UTSW	6	37,896,335 (GRCm39)	missense	probably benign	0.37
R5395:Trim24	UTSW	6	37,934,679 (GRCm39)	missense	probably damaging	1.00
R5547:Trim24	UTSW	6	37,942,485 (GRCm39)	missense	probably damaging	1.00
R5666:Trim24	UTSW	6	37,942,536 (GRCm39)	missense	probably benign	0.19
R5670:Trim24	UTSW	6	37,942,536 (GRCm39)	missense	probably benign	0.19
R5849:Trim24	UTSW	6	37,934,664 (GRCm39)	missense	probably damaging	1.00
R5927:Trim24	UTSW	6	37,935,504 (GRCm39)	missense	probably damaging	1.00
R5932:Trim24	UTSW	6	37,934,010 (GRCm39)	missense	probably damaging	0.99
R6286:Trim24	UTSW	6	37,896,426 (GRCm39)	critical splice donor site	probably null
R6374:Trim24	UTSW	6	37,930,484 (GRCm39)	missense	probably benign	0.12
R6449:Trim24	UTSW	6	37,880,587 (GRCm39)	critical splice donor site	probably null
R6723:Trim24	UTSW	6	37,928,403 (GRCm39)	missense	probably benign	0.00
R6731:Trim24	UTSW	6	37,920,420 (GRCm39)	missense	probably damaging	0.99
R6975:Trim24	UTSW	6	37,896,427 (GRCm39)	critical splice donor site	probably null
R7000:Trim24	UTSW	6	37,935,613 (GRCm39)	missense	probably benign	0.24
R7067:Trim24	UTSW	6	37,934,775 (GRCm39)	splice site	probably null
R7126:Trim24	UTSW	6	37,896,392 (GRCm39)	missense	probably damaging	1.00
R7162:Trim24	UTSW	6	37,942,456 (GRCm39)	missense	possibly damaging	0.68
R7486:Trim24	UTSW	6	37,934,774 (GRCm39)	critical splice donor site	probably null
R7779:Trim24	UTSW	6	37,896,333 (GRCm39)	missense	probably damaging	0.99
R7779:Trim24	UTSW	6	37,896,332 (GRCm39)	missense	probably damaging	1.00
R8070:Trim24	UTSW	6	37,934,661 (GRCm39)	missense	probably damaging	0.99
R8096:Trim24	UTSW	6	37,935,592 (GRCm39)	missense	probably benign	0.03
R8184:Trim24	UTSW	6	37,848,242 (GRCm39)	missense	probably damaging	1.00
R8323:Trim24	UTSW	6	37,892,233 (GRCm39)	critical splice donor site	probably null
R8476:Trim24	UTSW	6	37,922,578 (GRCm39)	nonsense	probably null
R8705:Trim24	UTSW	6	37,880,588 (GRCm39)	critical splice donor site	probably benign
R8770:Trim24	UTSW	6	37,934,435 (GRCm39)	splice site	probably benign
R9021:Trim24	UTSW	6	37,933,949 (GRCm39)	missense	probably damaging	0.99
R9166:Trim24	UTSW	6	37,934,074 (GRCm39)	missense	probably damaging	1.00
R9212:Trim24	UTSW	6	37,896,335 (GRCm39)	missense	probably benign	0.37
R9350:Trim24	UTSW	6	37,892,208 (GRCm39)	missense	probably damaging	1.00
R9678:Trim24	UTSW	6	37,942,449 (GRCm39)	missense	probably damaging	1.00
RF007:Trim24	UTSW	6	37,930,471 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACAGAAGCCATTGGGTGTGTG -3'
(R):5'- GCACTGTTTATTCCTAAGCTCAAC -3'

Sequencing Primer
(F):5'- CCATTGGGTGTGTGACTTAAAATTC -3'
(R):5'- AAGCTCAACTATTCACTATCATTCG -3'

Posted On

2016-07-22