Incidental Mutation 'R5292:Zfp39'
ID405208
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Namezinc finger protein 39
SynonymsZfp-39, CTfin33
MMRRC Submission 042875-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R5292 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58888153-58904225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58900589 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
Predicted Effect probably damaging
Transcript: ENSMUST00000102703
AA Change: T91A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: T91A

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148244
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,864,451 V641A possibly damaging Het
Akap2 T G 4: 57,855,356 S471R probably damaging Het
Apob A T 12: 8,005,912 M1465L probably benign Het
Astn1 T C 1: 158,580,363 probably null Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Col22a1 T C 15: 71,970,336 Y433C probably damaging Het
Crtc3 T C 7: 80,618,610 T154A possibly damaging Het
Dcc T C 18: 71,306,088 Y1241C probably damaging Het
Depdc1b T C 13: 108,373,842 V296A probably damaging Het
E430018J23Rik T C 7: 127,392,487 D97G possibly damaging Het
Gata3 A G 2: 9,868,874 S270P probably damaging Het
Gcm1 T C 9: 78,061,426 F136S probably damaging Het
Gfpt1 A G 6: 87,076,255 probably null Het
Gm5174 G T 10: 86,656,698 noncoding transcript Het
Hhipl1 A G 12: 108,327,778 T648A probably benign Het
Hr C A 14: 70,571,992 Q1177K probably damaging Het
Hrnr T C 3: 93,331,892 S3146P unknown Het
Igkv10-94 C T 6: 68,704,598 G86E probably damaging Het
Krt80 G A 15: 101,352,185 R222W probably damaging Het
Lrch3 T C 16: 32,975,807 Y354H probably damaging Het
Olfr1133 T A 2: 87,645,995 N43Y probably damaging Het
Olfr1510 A T 14: 52,410,445 N142K possibly damaging Het
Olfr401 T A 11: 74,122,051 F254Y probably damaging Het
Osbpl7 A G 11: 97,067,953 D932G probably benign Het
Palmd T C 3: 116,923,744 E368G probably benign Het
Peg3 T A 7: 6,708,260 D1321V probably damaging Het
Pkhd1l1 A T 15: 44,529,566 I1766F probably damaging Het
Polq A G 16: 37,061,383 E1303G probably damaging Het
Ppie A G 4: 123,139,908 Y9H probably damaging Het
Ptprz1 A G 6: 23,002,582 N1557S probably benign Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rtn4 T C 11: 29,707,924 F577L probably benign Het
Sacs A G 14: 61,211,983 Y3826C probably damaging Het
Slc32a1 A G 2: 158,611,387 D49G probably damaging Het
Slc37a2 A T 9: 37,239,157 C167* probably null Het
Slc5a1 G T 5: 33,158,241 V535F probably benign Het
Smoc2 A G 17: 14,336,573 K95E probably damaging Het
Smok3c A C 5: 138,065,184 Q311P probably damaging Het
Spink5 C A 18: 44,006,454 P628Q probably benign Het
Spint4 T C 2: 164,700,859 L124S probably benign Het
Stard9 A G 2: 120,699,145 K1961R probably benign Het
Synpo2 C A 3: 123,114,060 V536L possibly damaging Het
Trim24 A G 6: 37,903,604 K146E probably benign Het
Usp24 A G 4: 106,418,263 D2245G probably benign Het
Vars2 A G 17: 35,660,786 S81P probably damaging Het
Zfp936 T A 7: 43,189,335 Y75* probably null Het
Zkscan5 G T 5: 145,218,641 C374F probably damaging Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58893059 splice site probably benign
IGL01597:Zfp39 APN 11 58891543 missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58891330 missense probably benign
IGL02456:Zfp39 APN 11 58902800 nonsense probably null
IGL02873:Zfp39 APN 11 58891022 missense probably benign 0.12
H8562:Zfp39 UTSW 11 58900686 missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58890406 missense probably benign 0.03
R0513:Zfp39 UTSW 11 58889987 missense probably benign 0.09
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58890323 missense probably benign 0.01
R1797:Zfp39 UTSW 11 58900660 missense probably damaging 0.96
R2146:Zfp39 UTSW 11 58890332 missense probably benign 0.05
R3903:Zfp39 UTSW 11 58890175 missense probably benign 0.44
R4303:Zfp39 UTSW 11 58890017 missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58902807 missense probably benign 0.41
R4957:Zfp39 UTSW 11 58891231 missense possibly damaging 0.63
R5092:Zfp39 UTSW 11 58891202 missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58889845 missense possibly damaging 0.81
R5697:Zfp39 UTSW 11 58889835 missense probably benign 0.08
R5906:Zfp39 UTSW 11 58902891 missense probably benign
R5925:Zfp39 UTSW 11 58891273 missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58891387 missense probably benign 0.01
R6177:Zfp39 UTSW 11 58891061 missense probably benign 0.27
R6968:Zfp39 UTSW 11 58891480 missense probably benign 0.00
R7045:Zfp39 UTSW 11 58890443 missense unknown
R7139:Zfp39 UTSW 11 58890559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCCACAAAATAGCTAATAGAG -3'
(R):5'- CTCAGAGATGTGGCTCTTTCTG -3'

Sequencing Primer
(F):5'- GCAATATAAAGATGTGAGATGTCTGC -3'
(R):5'- AGAGATGTGGCTCTTTCTGAGGATG -3'
Posted On2016-07-22