Incidental Mutation 'R5292:Hr'
ID405217
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Namehairless
SynonymsALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
MMRRC Submission 042875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5292 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70552212-70573548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70571992 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1177 (Q1177K)
Ref Sequence ENSEMBL: ENSMUSP00000124042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
Predicted Effect probably damaging
Transcript: ENSMUST00000022691
AA Change: Q1148K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: Q1148K

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161069
AA Change: Q1148K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: Q1148K

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163060
AA Change: Q1177K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: Q1177K

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,864,451 V641A possibly damaging Het
Akap2 T G 4: 57,855,356 S471R probably damaging Het
Apob A T 12: 8,005,912 M1465L probably benign Het
Astn1 T C 1: 158,580,363 probably null Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Col22a1 T C 15: 71,970,336 Y433C probably damaging Het
Crtc3 T C 7: 80,618,610 T154A possibly damaging Het
Dcc T C 18: 71,306,088 Y1241C probably damaging Het
Depdc1b T C 13: 108,373,842 V296A probably damaging Het
E430018J23Rik T C 7: 127,392,487 D97G possibly damaging Het
Gata3 A G 2: 9,868,874 S270P probably damaging Het
Gcm1 T C 9: 78,061,426 F136S probably damaging Het
Gfpt1 A G 6: 87,076,255 probably null Het
Gm5174 G T 10: 86,656,698 noncoding transcript Het
Hhipl1 A G 12: 108,327,778 T648A probably benign Het
Hrnr T C 3: 93,331,892 S3146P unknown Het
Igkv10-94 C T 6: 68,704,598 G86E probably damaging Het
Krt80 G A 15: 101,352,185 R222W probably damaging Het
Lrch3 T C 16: 32,975,807 Y354H probably damaging Het
Olfr1133 T A 2: 87,645,995 N43Y probably damaging Het
Olfr1510 A T 14: 52,410,445 N142K possibly damaging Het
Olfr401 T A 11: 74,122,051 F254Y probably damaging Het
Osbpl7 A G 11: 97,067,953 D932G probably benign Het
Palmd T C 3: 116,923,744 E368G probably benign Het
Peg3 T A 7: 6,708,260 D1321V probably damaging Het
Pkhd1l1 A T 15: 44,529,566 I1766F probably damaging Het
Polq A G 16: 37,061,383 E1303G probably damaging Het
Ppie A G 4: 123,139,908 Y9H probably damaging Het
Ptprz1 A G 6: 23,002,582 N1557S probably benign Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rtn4 T C 11: 29,707,924 F577L probably benign Het
Sacs A G 14: 61,211,983 Y3826C probably damaging Het
Slc32a1 A G 2: 158,611,387 D49G probably damaging Het
Slc37a2 A T 9: 37,239,157 C167* probably null Het
Slc5a1 G T 5: 33,158,241 V535F probably benign Het
Smoc2 A G 17: 14,336,573 K95E probably damaging Het
Smok3c A C 5: 138,065,184 Q311P probably damaging Het
Spink5 C A 18: 44,006,454 P628Q probably benign Het
Spint4 T C 2: 164,700,859 L124S probably benign Het
Stard9 A G 2: 120,699,145 K1961R probably benign Het
Synpo2 C A 3: 123,114,060 V536L possibly damaging Het
Trim24 A G 6: 37,903,604 K146E probably benign Het
Usp24 A G 4: 106,418,263 D2245G probably benign Het
Vars2 A G 17: 35,660,786 S81P probably damaging Het
Zfp39 T C 11: 58,900,589 T91A probably damaging Het
Zfp936 T A 7: 43,189,335 Y75* probably null Het
Zkscan5 G T 5: 145,218,641 C374F probably damaging Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
general UTSW 14 70563684 critical splice donor site probably null
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site probably benign
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
subclinical UTSW 14 70561836 missense possibly damaging 0.89
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
R7030:Hr UTSW 14 70563684 critical splice donor site probably null
R7213:Hr UTSW 14 70558350 missense probably damaging 0.99
R7452:Hr UTSW 14 70571486 missense probably damaging 1.00
R7468:Hr UTSW 14 70558212 missense possibly damaging 0.89
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTTAGTGATCAGAGGCATGG -3'
(R):5'- TTCAATCGCGTTCCAGCACC -3'

Sequencing Primer
(F):5'- TGATCAGAGGCATGGAGGGG -3'
(R):5'- CTCAAGAACACCTTTATCTAGCACTG -3'
Posted On2016-07-22