Incidental Mutation 'R5294:Aste1'
ID405313
Institutional Source Beutler Lab
Gene Symbol Aste1
Ensembl Gene ENSMUSG00000032567
Gene Nameasteroid homolog 1
Synonyms1100001A21Rik
MMRRC Submission 042877-MU
Accession Numbers

Ncbi RefSeq: NM_025651.4, NM_001164828.1; MGI:1913845

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105395392-105412229 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 105402705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000123807] [ENSMUST00000167674] [ENSMUST00000176350] [ENSMUST00000176770] [ENSMUST00000176940] [ENSMUST00000177074] [ENSMUST00000177293] [ENSMUST00000177402] [ENSMUST00000189758]
Predicted Effect probably benign
Transcript: ENSMUST00000035181
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123807
Predicted Effect probably benign
Transcript: ENSMUST00000123807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137208
Predicted Effect probably null
Transcript: ENSMUST00000167674
SMART Domains Protein: ENSMUSP00000131164
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176597
Predicted Effect probably benign
Transcript: ENSMUST00000176770
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176940
Predicted Effect probably benign
Transcript: ENSMUST00000177074
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177293
SMART Domains Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 203 6.7e-64 PFAM
Pfam:Hydrolase 207 519 7.4e-32 PFAM
Pfam:HAD 210 516 1.9e-15 PFAM
Pfam:Hydrolase_like2 272 356 3.8e-20 PFAM
transmembrane domain 564 586 N/A INTRINSIC
Pfam:Cation_ATPase_C 589 761 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216711
Meta Mutation Damage Score 0.6312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
Allele List at MGI

All alleles(6) : Targeted(4) Gene trapped(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Aste1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Aste1 APN 9 105397844 missense probably damaging 0.99
IGL03161:Aste1 APN 9 105396672 missense probably damaging 1.00
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R1485:Aste1 UTSW 9 105397810 nonsense probably null
R2010:Aste1 UTSW 9 105403502 missense probably damaging 1.00
R5048:Aste1 UTSW 9 105396989 missense probably damaging 1.00
R5084:Aste1 UTSW 9 105397687 nonsense probably null
R5091:Aste1 UTSW 9 105405004 missense probably damaging 1.00
R5197:Aste1 UTSW 9 105405054 missense probably damaging 1.00
R5617:Aste1 UTSW 9 105397835 missense probably benign 0.00
R5834:Aste1 UTSW 9 105403415 missense probably benign 0.01
R6214:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6215:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6249:Aste1 UTSW 9 105396617 missense probably benign 0.00
R6913:Aste1 UTSW 9 105397408 missense probably benign 0.01
R7069:Aste1 UTSW 9 105396707 critical splice donor site probably null
R7155:Aste1 UTSW 9 105405136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGACTGGTGTATTCTATGCG -3'
(R):5'- CAACAACCTGCGTAGATGC -3'

Sequencing Primer
(F):5'- CCCTAGTACTCGAGCTTATGATAG -3'
(R):5'- TGCGTAGATGCAGCTTCTG -3'
Posted On2016-07-22