Mutagenetix > Incidental Mutation

Incidental Mutation 'R5298:Spag9'

405543

Institutional Source

Beutler Lab

Gene Symbol

Spag9

Ensembl Gene

ENSMUSG00000020859

Gene Name

sperm associated antigen 9

Synonyms

JLP, Mapk8ip4, 3110018C07Rik, JIP4, 4733401I23Rik, syd1, 4831406C20Rik

MMRRC Submission

042881-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.737) question?

Stock #

R5298 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93886917-94016911 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93990961 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 626 (W626R)

Ref Sequence

ENSEMBL: ENSMUSP00000118850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079] [ENSMUST00000153076]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000024979
AA Change: W838R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: W838R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	253	305	1e-25	PDB
low complexity region	306	339	N/A	INTRINSIC
coiled coil region	572	606	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC
SCOP:d1kb0a2	823	969	3e-5	SMART
Blast:WD40	924	964	8e-18	BLAST
low complexity region	1132	1150	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000041956
AA Change: W976R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: W976R

Domain	Start	End	E-Value	Type
Pfam:Jnk-SapK_ap_N	24	179	2e-61	PFAM
Pfam:JIP_LZII	390	460	5.3e-32	PFAM
coiled coil region	710	744	N/A	INTRINSIC
low complexity region	873	889	N/A	INTRINSIC
SCOP:d1kb0a2	961	1107	1e-5	SMART
Blast:WD40	1062	1102	1e-17	BLAST
low complexity region	1270	1288	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075695
AA Change: W837R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: W837R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	253	305	1e-25	PDB
low complexity region	306	339	N/A	INTRINSIC
coiled coil region	571	605	N/A	INTRINSIC
low complexity region	734	750	N/A	INTRINSIC
SCOP:d1kb0a2	822	968	3e-5	SMART
Blast:WD40	923	963	7e-18	BLAST
low complexity region	1131	1149	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000092777
AA Change: W838R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: W838R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	254	306	1e-25	PDB
low complexity region	307	340	N/A	INTRINSIC
coiled coil region	572	606	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC
SCOP:d1kb0a2	823	969	3e-5	SMART
Blast:WD40	924	964	7e-18	BLAST
low complexity region	1132	1150	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103168
AA Change: W833R

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: W833R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	249	301	1e-25	PDB
low complexity region	302	335	N/A	INTRINSIC
coiled coil region	567	601	N/A	INTRINSIC
low complexity region	730	746	N/A	INTRINSIC
SCOP:d1kb0a2	818	964	3e-5	SMART
Blast:WD40	919	959	8e-18	BLAST
low complexity region	1127	1145	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000132079
AA Change: W626R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859
AA Change: W626R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
coiled coil region	360	394	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000153076
AA Change: W557R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: W557R

Domain	Start	End	E-Value	Type
PDB:2W83\|D	1	25	4e-8	PDB
low complexity region	26	59	N/A	INTRINSIC
coiled coil region	291	325	N/A	INTRINSIC
low complexity region	454	470	N/A	INTRINSIC
SCOP:d1kb0a2	542	688	3e-5	SMART
Blast:WD40	643	683	1e-17	BLAST
low complexity region	864	882	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156019

SMART Domains

Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
Pfam:JIP_LZII	240	310	1.1e-32	PFAM
coiled coil region	559	593	N/A	INTRINSIC
low complexity region	723	739	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr4	A	G	9: 103,976,086 (GRCm39)	V287A	possibly damaging	Het
Adat2	A	G	10: 13,432,650 (GRCm39)	N51D	probably benign	Het
Alms1-ps1	T	C	6: 85,729,100 (GRCm39)		noncoding transcript	Het
Ccdc97	A	G	7: 25,415,432 (GRCm39)	V12A	probably damaging	Het
Cdcp2	T	C	4: 106,964,182 (GRCm39)	V344A	probably benign	Het
Clasp1	A	G	1: 118,475,650 (GRCm39)	D929G	possibly damaging	Het
Clip4	A	G	17: 72,141,220 (GRCm39)	N525D	probably damaging	Het
Csde1	T	A	3: 102,954,525 (GRCm39)		probably null	Het
D330020A13Rik	T	C	6: 120,271,777 (GRCm39)		probably benign	Het
Dnah2	C	T	11: 69,349,746 (GRCm39)	R2399Q	probably benign	Het
Ehmt2	C	T	17: 35,118,067 (GRCm39)	R40*	probably null	Het
Fuca1	C	A	4: 135,664,237 (GRCm39)	Y374*	probably null	Het
Gle1	C	G	2: 29,838,955 (GRCm39)	P457A	probably benign	Het
Hadhb	T	C	5: 30,382,009 (GRCm39)		probably null	Het
Klhl18	G	C	9: 110,265,195 (GRCm39)	N335K	possibly damaging	Het
Lef1	A	T	3: 130,988,316 (GRCm39)	R294S	possibly damaging	Het
Lrriq4	G	T	3: 30,699,481 (GRCm39)	M1I	probably null	Het
Magi2	T	C	5: 20,774,160 (GRCm39)	S884P	probably damaging	Het
Mon2	A	G	10: 122,846,511 (GRCm39)	I1353T	probably benign	Het
Or4c127	T	A	2: 89,832,804 (GRCm39)	L18Q	possibly damaging	Het
Or5p81	A	G	7: 108,267,279 (GRCm39)	I219V	probably benign	Het
Parg	C	A	14: 31,924,210 (GRCm39)	A3E	probably damaging	Het
Per3	A	T	4: 151,113,666 (GRCm39)	D297E	probably damaging	Het
Pkhd1l1	A	T	15: 44,367,442 (GRCm39)	Y780F	probably benign	Het
Plcg2	A	G	8: 118,331,988 (GRCm39)	Y858C	probably benign	Het
Prkca	A	T	11: 107,903,510 (GRCm39)	N287K	probably damaging	Het
Qsox2	A	C	2: 26,104,074 (GRCm39)	S484A	probably damaging	Het
Reep4	G	A	14: 70,785,637 (GRCm39)	G225D	possibly damaging	Het
Scn4a	T	C	11: 106,230,212 (GRCm39)	E532G	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,103,384 (GRCm39)		probably benign	Het
Slc23a1	A	G	18: 35,755,563 (GRCm39)		probably null	Het
Sowaha	C	T	11: 53,370,355 (GRCm39)	R127Q	probably benign	Het
Tasor2	T	C	13: 3,645,613 (GRCm39)		probably null	Het
Trim45	A	G	3: 100,832,787 (GRCm39)	D340G	probably damaging	Het
Vmn1r193	A	T	13: 22,403,725 (GRCm39)	F89Y	probably damaging	Het
Zfp507	T	C	7: 35,475,421 (GRCm39)	N931D	probably damaging	Het

Other mutations in Spag9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Spag9	APN	11	93,988,692 (GRCm39)	missense	probably benign	0.02
IGL01776:Spag9	APN	11	94,007,553 (GRCm39)	splice site	probably benign
IGL02095:Spag9	APN	11	93,999,408 (GRCm39)	missense	probably damaging	1.00
IGL02307:Spag9	APN	11	93,992,986 (GRCm39)	critical splice donor site	probably null
IGL02417:Spag9	APN	11	94,007,567 (GRCm39)	missense	probably benign	0.27
IGL02480:Spag9	APN	11	93,999,413 (GRCm39)	nonsense	probably null
IGL02864:Spag9	APN	11	93,997,487 (GRCm39)	missense	probably damaging	1.00
IGL02976:Spag9	APN	11	93,974,779 (GRCm39)	missense	probably benign	0.30
IGL02979:Spag9	APN	11	93,988,190 (GRCm39)	missense	probably benign
IGL03349:Spag9	APN	11	93,984,335 (GRCm39)	missense	possibly damaging	0.51
dazzle	UTSW	11	93,984,450 (GRCm39)	nonsense	probably null
R0128:Spag9	UTSW	11	93,984,365 (GRCm39)	missense	probably damaging	1.00
R0418:Spag9	UTSW	11	93,982,579 (GRCm39)	splice site	probably benign
R1463:Spag9	UTSW	11	94,007,663 (GRCm39)	missense	probably damaging	1.00
R1593:Spag9	UTSW	11	93,988,059 (GRCm39)	missense	probably damaging	1.00
R1605:Spag9	UTSW	11	93,939,365 (GRCm39)	missense	probably damaging	0.99
R1649:Spag9	UTSW	11	93,999,278 (GRCm39)	splice site	probably null
R1697:Spag9	UTSW	11	93,887,391 (GRCm39)	missense	probably benign	0.00
R1952:Spag9	UTSW	11	93,988,184 (GRCm39)	missense	possibly damaging	0.77
R2011:Spag9	UTSW	11	93,983,201 (GRCm39)	nonsense	probably null
R2012:Spag9	UTSW	11	93,983,201 (GRCm39)	nonsense	probably null
R2351:Spag9	UTSW	11	93,983,726 (GRCm39)	missense	probably damaging	1.00
R2367:Spag9	UTSW	11	94,007,583 (GRCm39)	missense	probably damaging	1.00
R3027:Spag9	UTSW	11	93,977,203 (GRCm39)	missense	probably null	1.00
R3766:Spag9	UTSW	11	93,951,109 (GRCm39)	intron	probably benign
R3777:Spag9	UTSW	11	93,989,852 (GRCm39)	critical splice acceptor site	probably null
R3937:Spag9	UTSW	11	93,935,305 (GRCm39)	missense	possibly damaging	0.92
R3937:Spag9	UTSW	11	93,935,243 (GRCm39)	missense	possibly damaging	0.94
R4417:Spag9	UTSW	11	93,951,172 (GRCm39)	intron	probably benign
R4445:Spag9	UTSW	11	93,988,079 (GRCm39)	missense	possibly damaging	0.95
R4711:Spag9	UTSW	11	94,005,177 (GRCm39)	critical splice donor site	probably null
R4799:Spag9	UTSW	11	93,939,343 (GRCm39)	missense	probably damaging	0.96
R4799:Spag9	UTSW	11	93,939,342 (GRCm39)	missense	possibly damaging	0.87
R4816:Spag9	UTSW	11	93,939,425 (GRCm39)	intron	probably benign
R4843:Spag9	UTSW	11	93,988,644 (GRCm39)	missense	probably damaging	1.00
R5020:Spag9	UTSW	11	93,988,612 (GRCm39)	missense	probably benign	0.08
R5119:Spag9	UTSW	11	94,013,548 (GRCm39)	missense	probably damaging	1.00
R5304:Spag9	UTSW	11	93,959,838 (GRCm39)	missense	probably damaging	1.00
R5305:Spag9	UTSW	11	93,959,838 (GRCm39)	missense	probably damaging	1.00
R5395:Spag9	UTSW	11	93,982,577 (GRCm39)	splice site	probably null
R5636:Spag9	UTSW	11	93,959,838 (GRCm39)	missense	probably damaging	1.00
R5638:Spag9	UTSW	11	93,959,838 (GRCm39)	missense	probably damaging	1.00
R5654:Spag9	UTSW	11	93,981,538 (GRCm39)	missense	probably damaging	1.00
R5779:Spag9	UTSW	11	94,005,079 (GRCm39)	missense	probably benign	0.20
R5814:Spag9	UTSW	11	93,973,654 (GRCm39)	missense	possibly damaging	0.94
R5912:Spag9	UTSW	11	93,935,251 (GRCm39)	missense	probably damaging	0.98
R6038:Spag9	UTSW	11	94,002,918 (GRCm39)	missense	probably damaging	1.00
R6038:Spag9	UTSW	11	94,002,918 (GRCm39)	missense	probably damaging	1.00
R6269:Spag9	UTSW	11	93,935,333 (GRCm39)	missense	probably benign	0.05
R6294:Spag9	UTSW	11	93,984,311 (GRCm39)	critical splice acceptor site	probably null
R6389:Spag9	UTSW	11	93,977,137 (GRCm39)	missense	probably damaging	1.00
R6420:Spag9	UTSW	11	93,977,128 (GRCm39)	missense	probably damaging	1.00
R6460:Spag9	UTSW	11	93,959,801 (GRCm39)	missense	probably damaging	1.00
R6482:Spag9	UTSW	11	93,984,328 (GRCm39)	missense	possibly damaging	0.94
R6860:Spag9	UTSW	11	93,972,196 (GRCm39)	missense	probably benign	0.25
R7086:Spag9	UTSW	11	93,988,690 (GRCm39)	missense	probably benign
R7179:Spag9	UTSW	11	93,980,258 (GRCm39)	splice site	probably null
R7225:Spag9	UTSW	11	93,988,184 (GRCm39)	missense	probably damaging	0.98
R7351:Spag9	UTSW	11	93,983,802 (GRCm39)	missense	probably benign	0.00
R7366:Spag9	UTSW	11	93,999,347 (GRCm39)	missense	possibly damaging	0.56
R7378:Spag9	UTSW	11	94,005,177 (GRCm39)	critical splice donor site	probably null
R7401:Spag9	UTSW	11	93,988,515 (GRCm39)	missense	probably benign
R7506:Spag9	UTSW	11	93,999,290 (GRCm39)	missense	probably damaging	1.00
R7507:Spag9	UTSW	11	93,958,906 (GRCm39)	missense	probably benign	0.00
R7513:Spag9	UTSW	11	94,002,909 (GRCm39)	missense	probably damaging	1.00
R7655:Spag9	UTSW	11	93,887,389 (GRCm39)	missense	possibly damaging	0.56
R7656:Spag9	UTSW	11	93,887,389 (GRCm39)	missense	possibly damaging	0.56
R7664:Spag9	UTSW	11	93,992,986 (GRCm39)	critical splice donor site	probably null
R7665:Spag9	UTSW	11	93,904,480 (GRCm39)	missense	probably damaging	0.98
R7862:Spag9	UTSW	11	94,002,892 (GRCm39)	missense	possibly damaging	0.69
R8074:Spag9	UTSW	11	94,002,877 (GRCm39)	missense	probably damaging	1.00
R8085:Spag9	UTSW	11	93,989,870 (GRCm39)	missense	probably benign
R8469:Spag9	UTSW	11	93,982,627 (GRCm39)	missense	probably damaging	1.00
R8547:Spag9	UTSW	11	94,013,647 (GRCm39)	missense	possibly damaging	0.84
R8709:Spag9	UTSW	11	93,958,916 (GRCm39)	missense	probably benign	0.02
R8732:Spag9	UTSW	11	93,962,514 (GRCm39)	critical splice donor site	probably null
R8899:Spag9	UTSW	11	93,983,695 (GRCm39)	missense	probably damaging	1.00
R8983:Spag9	UTSW	11	93,958,815 (GRCm39)	missense	probably benign
R9043:Spag9	UTSW	11	93,951,085 (GRCm39)	missense
R9050:Spag9	UTSW	11	93,935,294 (GRCm39)	missense	probably damaging	0.97
R9502:Spag9	UTSW	11	93,959,792 (GRCm39)	missense	probably damaging	1.00
R9575:Spag9	UTSW	11	93,962,409 (GRCm39)	missense	probably damaging	0.99
R9667:Spag9	UTSW	11	93,887,119 (GRCm39)	missense	possibly damaging	0.83
R9683:Spag9	UTSW	11	93,988,568 (GRCm39)	missense	probably damaging	1.00
R9774:Spag9	UTSW	11	94,005,062 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGGGTAATCATGCGCTTCTG -3'
(R):5'- GCTTGCATACTGATTTGTCATGAG -3'

Sequencing Primer
(F):5'- CGCTTCTGTTTATGTTGATAGCC -3'
(R):5'- AGAACTAGCTGCTCTTCTAGAGGTC -3'

Posted On

2016-07-22