Incidental Mutation 'R5299:Axin1'
ID405589
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission 042882-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5299 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26173734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 330 (S330G)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074370
AA Change: S330G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: S330G

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118904
AA Change: S330G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: S330G

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163421
AA Change: S330G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: S330G

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168282
SMART Domains Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
coiled coil region 126 154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,431,861 I3838V probably damaging Het
Arid1a A T 4: 133,687,226 D1231E unknown Het
Atxn1 A T 13: 45,557,254 I734K probably benign Het
Bend3 G A 10: 43,493,690 probably null Het
Chodl C T 16: 78,941,408 T88I probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dst A G 1: 34,135,092 I179M probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Exoc2 A T 13: 30,871,918 probably null Het
Grk2 T C 19: 4,292,771 E45G probably damaging Het
Ift81 T C 5: 122,607,056 Y144C probably damaging Het
Ighv1-15 T C 12: 114,657,378 D109G probably damaging Het
Igtp T C 11: 58,207,133 W377R possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map2k6 A G 11: 110,492,963 D145G probably benign Het
Mcph1 T C 8: 18,652,580 probably benign Het
Mdfi A G 17: 47,820,834 V95A possibly damaging Het
Mical3 A G 6: 120,959,512 L1351P possibly damaging Het
Nbas C T 12: 13,441,925 Q1506* probably null Het
Nelfb A G 2: 25,210,745 V128A probably benign Het
Otog A G 7: 46,288,851 T1995A probably benign Het
Ppp1r7 A T 1: 93,352,626 I139L probably benign Het
Ppp2r1b A G 9: 50,857,040 D19G probably benign Het
Proca1 T C 11: 78,205,252 S150P probably damaging Het
Rhof A G 5: 123,120,548 V100A probably damaging Het
Rsbn1 G C 3: 103,914,490 G14R probably benign Het
Serinc1 A G 10: 57,523,051 I252T probably damaging Het
Skint4 A T 4: 112,136,006 I309F possibly damaging Het
Slc12a3 A G 8: 94,351,789 Y815C probably damaging Het
Slc25a24 A G 3: 109,166,352 S424G probably benign Het
Spint2 G A 7: 29,263,726 A49V probably damaging Het
Traf3ip3 T A 1: 193,178,175 K480* probably null Het
Ube2g2 T C 10: 77,644,545 S162P possibly damaging Het
Ubxn8 C A 8: 33,641,919 V7L possibly damaging Het
Vmn1r200 T A 13: 22,395,775 C249* probably null Het
Vmn1r38 T A 6: 66,776,698 T145S probably benign Het
Wapl G A 14: 34,733,808 probably null Het
Wfdc6a T C 2: 164,580,391 N96S possibly damaging Het
Zfp503 A G 14: 21,985,439 S470P probably benign Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTACATGCTCTTTCTGCTC -3'
(R):5'- CCACTTACAGGGTAGTCTGTCATC -3'

Sequencing Primer
(F):5'- ACATGCTCTTTCTGCTCTGTTTTTAG -3'
(R):5'- CTCACAAGCATCTGTAGTGGGATC -3'
Posted On2016-07-22