Incidental Mutation 'R5300:Gm136'
ID405597
Institutional Source Beutler Lab
Gene Symbol Gm136
Ensembl Gene ENSMUSG00000071015
Gene Namepredicted gene 136
SynonymsLOC214568
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location34743784-34756263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34750930 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 114 (K114N)
Ref Sequence ENSEMBL: ENSMUSP00000092748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095129]
Predicted Effect probably damaging
Transcript: ENSMUST00000095129
AA Change: K114N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092748
Gene: ENSMUSG00000071015
AA Change: K114N

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
coiled coil region 119 189 N/A INTRINSIC
coiled coil region 223 251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Gm136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gm136 APN 4 34752322 missense probably damaging 1.00
R0104:Gm136 UTSW 4 34746593 missense possibly damaging 0.65
R0108:Gm136 UTSW 4 34746593 missense possibly damaging 0.65
R1221:Gm136 UTSW 4 34744127 missense possibly damaging 0.71
R1635:Gm136 UTSW 4 34750919 critical splice donor site probably null
R1674:Gm136 UTSW 4 34746662 splice site probably benign
R1971:Gm136 UTSW 4 34755986 missense probably benign 0.00
R2496:Gm136 UTSW 4 34746541 missense probably damaging 1.00
R4441:Gm136 UTSW 4 34755911 missense probably benign 0.35
R4901:Gm136 UTSW 4 34746580 nonsense probably null
R6609:Gm136 UTSW 4 34746526 missense probably benign
R6709:Gm136 UTSW 4 34755884 missense probably damaging 1.00
R6824:Gm136 UTSW 4 34746591 missense probably benign 0.15
R7098:Gm136 UTSW 4 34746628 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTATGAAACCAAATGCCCAGAAGG -3'
(R):5'- AATAGTGACCCAGCTTCTCCC -3'

Sequencing Primer
(F):5'- TTTGTCAAGGCACAGTACTGGAC -3'
(R):5'- GACCCAGCTTCTCCCTCTCTG -3'
Posted On2016-07-22