Incidental Mutation 'R5313:Fam135a'
ID405676
Institutional Source Beutler Lab
Gene Symbol Fam135a
Ensembl Gene ENSMUSG00000026153
Gene Namefamily with sequence similarity 135, member A
Synonyms4921533L14Rik
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R5313 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location24011093-24100341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24028585 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 168 (I168V)
Ref Sequence ENSEMBL: ENSMUSP00000140947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027337] [ENSMUST00000185807] [ENSMUST00000186331] [ENSMUST00000186999] [ENSMUST00000187369] [ENSMUST00000187752] [ENSMUST00000188712]
Predicted Effect probably benign
Transcript: ENSMUST00000027337
AA Change: I1068V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027337
Gene: ENSMUSG00000026153
AA Change: I1068V

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
coiled coil region 270 295 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 1072 1085 N/A INTRINSIC
Blast:LRRNT 1139 1172 4e-6 BLAST
low complexity region 1173 1184 N/A INTRINSIC
Pfam:DUF676 1235 1431 9e-65 PFAM
Pfam:PGAP1 1237 1440 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185807
SMART Domains Protein: ENSMUSP00000140078
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Blast:LRRNT 27 60 4e-7 BLAST
low complexity region 61 72 N/A INTRINSIC
Pfam:DUF676 104 161 2.2e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186331
AA Change: I168V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140947
Gene: ENSMUSG00000026153
AA Change: I168V

DomainStartEndE-ValueType
low complexity region 172 185 N/A INTRINSIC
Blast:LRRNT 239 272 1e-6 BLAST
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186999
SMART Domains Protein: ENSMUSP00000140198
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 1.8e-15 PFAM
Pfam:DUF3657 338 395 7.3e-8 PFAM
low complexity region 672 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187369
AA Change: I872V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140766
Gene: ENSMUSG00000026153
AA Change: I872V

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 3e-15 PFAM
coiled coil region 270 295 N/A INTRINSIC
Pfam:DUF3657 312 369 1.2e-7 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Blast:LRRNT 943 976 4e-6 BLAST
low complexity region 977 988 N/A INTRINSIC
Pfam:DUF676 1039 1235 6.8e-62 PFAM
Pfam:PGAP1 1041 1259 8.1e-5 PFAM
Pfam:LCAT 1097 1203 2.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187619
Predicted Effect probably benign
Transcript: ENSMUST00000187752
AA Change: I855V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139633
Gene: ENSMUSG00000026153
AA Change: I855V

DomainStartEndE-ValueType
Pfam:DUF3657 68 130 3e-15 PFAM
Pfam:DUF3657 295 352 1.2e-7 PFAM
low complexity region 629 640 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Blast:LRRNT 926 959 4e-6 BLAST
low complexity region 960 971 N/A INTRINSIC
Pfam:DUF676 1022 1218 6.7e-62 PFAM
Pfam:PGAP1 1024 1242 8e-5 PFAM
Pfam:LCAT 1080 1186 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188712
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Fam135a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Fam135a APN 1 24055898 missense probably damaging 1.00
IGL01993:Fam135a APN 1 24055911 missense probably damaging 0.99
IGL02172:Fam135a APN 1 24024780 critical splice donor site probably null
IGL02832:Fam135a APN 1 24028633 missense probably benign 0.00
IGL03075:Fam135a APN 1 24030906 splice site probably benign
IGL03197:Fam135a APN 1 24044182 missense probably damaging 1.00
IGL03214:Fam135a APN 1 24053276 missense probably damaging 1.00
IGL03355:Fam135a APN 1 24029168 missense possibly damaging 0.93
PIT4434001:Fam135a UTSW 1 24029195 missense probably benign
R0276:Fam135a UTSW 1 24067964 missense probably damaging 1.00
R1429:Fam135a UTSW 1 24044267 missense probably damaging 1.00
R1553:Fam135a UTSW 1 24021870 missense probably damaging 0.97
R1582:Fam135a UTSW 1 24029317 missense probably damaging 1.00
R1686:Fam135a UTSW 1 24029806 missense probably benign 0.05
R1732:Fam135a UTSW 1 24026653 missense possibly damaging 0.71
R1859:Fam135a UTSW 1 24030225 missense probably damaging 1.00
R1954:Fam135a UTSW 1 24029602 missense probably damaging 1.00
R2266:Fam135a UTSW 1 24028797 missense probably benign 0.22
R2570:Fam135a UTSW 1 24021964 missense probably damaging 1.00
R3725:Fam135a UTSW 1 24057434 nonsense probably null
R3740:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3741:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3765:Fam135a UTSW 1 24055877 missense possibly damaging 0.95
R3792:Fam135a UTSW 1 24028311 missense probably benign 0.14
R3940:Fam135a UTSW 1 24057475 missense probably damaging 0.98
R3946:Fam135a UTSW 1 24030394 missense probably damaging 0.96
R4754:Fam135a UTSW 1 24028754 nonsense probably null
R4794:Fam135a UTSW 1 24029160 missense probably benign 0.36
R4887:Fam135a UTSW 1 24024253 nonsense probably null
R4891:Fam135a UTSW 1 24030328 missense probably benign 0.00
R4929:Fam135a UTSW 1 24030000 missense probably benign 0.16
R4999:Fam135a UTSW 1 24020677 missense possibly damaging 0.83
R5092:Fam135a UTSW 1 24028807 missense probably benign 0.11
R5205:Fam135a UTSW 1 24029511 missense probably benign 0.05
R5579:Fam135a UTSW 1 24029727 missense possibly damaging 0.93
R5689:Fam135a UTSW 1 24029053 missense probably benign 0.22
R5863:Fam135a UTSW 1 24014782 missense possibly damaging 0.94
R5869:Fam135a UTSW 1 24029430 missense possibly damaging 0.53
R6128:Fam135a UTSW 1 24030740 critical splice donor site probably null
R6505:Fam135a UTSW 1 24014872 missense probably damaging 1.00
R6668:Fam135a UTSW 1 24028848 missense probably damaging 0.99
R6793:Fam135a UTSW 1 24067925 missense possibly damaging 0.69
R6857:Fam135a UTSW 1 24014789 missense probably damaging 0.99
R6931:Fam135a UTSW 1 24085487 start codon destroyed probably damaging 1.00
R6977:Fam135a UTSW 1 24054098 missense probably damaging 1.00
R7187:Fam135a UTSW 1 24044214 missense probably damaging 1.00
R7206:Fam135a UTSW 1 24030273 missense probably benign 0.14
R7305:Fam135a UTSW 1 24030858 missense probably damaging 1.00
R7313:Fam135a UTSW 1 24057392 missense probably damaging 0.98
R7420:Fam135a UTSW 1 24012486 missense possibly damaging 0.68
X0022:Fam135a UTSW 1 24030214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCAGCACTCAGATAGTTG -3'
(R):5'- GCGGTGAGCCATTAAATCAC -3'

Sequencing Primer
(F):5'- CAGCACTCAGATAGTTGCTGCTTAG -3'
(R):5'- GTGAGCCATTAAATCACAAACAAGTG -3'
Posted On2016-07-22