Incidental Mutation 'R5313:Glp2r'
ID405710
Institutional Source Beutler Lab
Gene Symbol Glp2r
Ensembl Gene ENSMUSG00000049928
Gene Nameglucagon-like peptide 2 receptor
SynonymsGLP-2, 9530092J08Rik
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5313 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67661502-67771153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67757531 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 115 (D115G)
Ref Sequence ENSEMBL: ENSMUSP00000061560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000051765]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051765
AA Change: D115G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061560
Gene: ENSMUSG00000049928
AA Change: D115G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:HRM 53 122 3.4e-16 PFAM
Pfam:7tm_2 137 394 1.5e-79 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null mutation display defects in Paneth cell physiology, increased small bowel bacterial loads, and increased susceptibility to small bowel injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Glp2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Glp2r APN 11 67709644 missense probably benign
IGL02244:Glp2r APN 11 67721991 missense probably damaging 1.00
IGL02484:Glp2r APN 11 67740166 missense possibly damaging 0.90
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0195:Glp2r UTSW 11 67709708 missense probably damaging 0.99
R1612:Glp2r UTSW 11 67742207 missense possibly damaging 0.46
R1699:Glp2r UTSW 11 67757541 missense probably benign 0.09
R1944:Glp2r UTSW 11 67746792 missense probably benign 0.01
R3971:Glp2r UTSW 11 67746815 missense possibly damaging 0.65
R4417:Glp2r UTSW 11 67664516 intron probably benign
R4681:Glp2r UTSW 11 67730627 splice site probably null
R4914:Glp2r UTSW 11 67757593 nonsense probably null
R4918:Glp2r UTSW 11 67757593 nonsense probably null
R4938:Glp2r UTSW 11 67757593 nonsense probably null
R4940:Glp2r UTSW 11 67757593 nonsense probably null
R4941:Glp2r UTSW 11 67746703 splice site probably null
R4963:Glp2r UTSW 11 67757593 nonsense probably null
R4966:Glp2r UTSW 11 67757593 nonsense probably null
R5023:Glp2r UTSW 11 67741032 missense possibly damaging 0.82
R5121:Glp2r UTSW 11 67722100 splice site probably null
R5705:Glp2r UTSW 11 67709739 missense probably benign 0.30
R5790:Glp2r UTSW 11 67764799 missense probably damaging 1.00
R6074:Glp2r UTSW 11 67746814 missense unknown
R6595:Glp2r UTSW 11 67764777 missense probably benign 0.10
R6910:Glp2r UTSW 11 67730671 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCAATGGGAGTTGCTGTTC -3'
(R):5'- ACGAAACCCTCTTTCCCTGG -3'

Sequencing Primer
(F):5'- CAATGGGAGTTGCTGTTCTGGTG -3'
(R):5'- GGGATTTTCCACAGCTTTTTAGC -3'
Posted On2016-07-22