Incidental Mutation 'R5313:Cdh6'
ID405714
Institutional Source Beutler Lab
Gene Symbol Cdh6
Ensembl Gene ENSMUSG00000039385
Gene Namecadherin 6
Synonymscad6, K-cadherin
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R5313 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location13028701-13173675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13034637 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 646 (I646F)
Ref Sequence ENSEMBL: ENSMUSP00000037113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036439]
PDB Structure
Crystal structure of cadherin-6 EC12 W4A [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036439
AA Change: I646F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037113
Gene: ENSMUSG00000039385
AA Change: I646F

DomainStartEndE-ValueType
CA 76 157 7e-15 SMART
CA 181 266 9.06e-32 SMART
CA 290 382 1.14e-19 SMART
CA 405 486 8.81e-21 SMART
CA 509 596 2.82e-10 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 5.6e-57 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit delay in mesenchyme-to-epithelial conversion and a loss of nephrons. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed mesenchyme to epithelial conversion and loss of nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Cdh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Cdh6 APN 15 13034359 nonsense probably null
IGL00675:Cdh6 APN 15 13041439 missense possibly damaging 0.80
IGL01063:Cdh6 APN 15 13064495 missense probably damaging 1.00
IGL01335:Cdh6 APN 15 13051309 missense probably benign 0.40
IGL01351:Cdh6 APN 15 13034240 missense possibly damaging 0.55
IGL02010:Cdh6 APN 15 13034190 utr 3 prime probably benign
IGL02428:Cdh6 APN 15 13064430 missense possibly damaging 0.94
PIT4651001:Cdh6 UTSW 15 13044719 missense possibly damaging 0.69
R0124:Cdh6 UTSW 15 13034324 missense probably damaging 1.00
R0256:Cdh6 UTSW 15 13053782 splice site probably benign
R0696:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R1017:Cdh6 UTSW 15 13051476 missense probably benign 0.06
R1240:Cdh6 UTSW 15 13057455 missense possibly damaging 0.48
R1444:Cdh6 UTSW 15 13091838 missense probably benign 0.00
R2008:Cdh6 UTSW 15 13051476 missense possibly damaging 0.74
R2050:Cdh6 UTSW 15 13057501 missense probably benign
R2507:Cdh6 UTSW 15 13041361 missense probably benign 0.10
R3082:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3083:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3903:Cdh6 UTSW 15 13042575 missense probably benign 0.39
R4591:Cdh6 UTSW 15 13051486 missense possibly damaging 0.69
R4859:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R4898:Cdh6 UTSW 15 13034688 missense probably damaging 0.99
R5242:Cdh6 UTSW 15 13064411 missense probably benign 0.05
R5545:Cdh6 UTSW 15 13041149 missense probably damaging 1.00
R6360:Cdh6 UTSW 15 13041460 missense possibly damaging 0.82
R6650:Cdh6 UTSW 15 13051401 missense probably benign 0.11
R6830:Cdh6 UTSW 15 13044774 missense probably benign 0.01
R7369:Cdh6 UTSW 15 13042638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGACATCCGTGTTGTCAC -3'
(R):5'- AAGGTATCCTTAACTCTGGGACAAG -3'

Sequencing Primer
(F):5'- TCACGAGCTGTTGGAGTCC -3'
(R):5'- TAACTCTGGGACAAGTTAAGCCTGC -3'
Posted On2016-07-22