Incidental Mutation 'R5314:Pde8b'
ID405759
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 042897-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R5314 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95086853 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 298 (F298L)
Ref Sequence ENSEMBL: ENSMUSP00000128987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000067082] [ENSMUST00000159608] [ENSMUST00000160957] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect probably benign
Transcript: ENSMUST00000022192
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067082
AA Change: F278L

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: F278L

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159608
SMART Domains Protein: ENSMUSP00000125191
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDE8 1 52 1.7e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.1e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 666 9.37e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160957
SMART Domains Protein: ENSMUSP00000125115
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Response_reg 30 148 5.7e-16 PFAM
Blast:PAS 165 188 1e-7 BLAST
Blast:HDc 266 327 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000162153
AA Change: F193L

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: F193L

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162292
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162328
Predicted Effect probably benign
Transcript: ENSMUST00000162412
AA Change: F193L

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684
AA Change: F193L

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172104
AA Change: F298L

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: F298L

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik T C 3: 121,679,523 F109S unknown Het
Ankhd1 A T 18: 36,561,058 probably null Het
Atp8a1 C T 5: 67,705,905 probably null Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc136 G T 6: 29,417,498 V707F probably benign Het
Ccdc157 A T 11: 4,150,078 C91* probably null Het
Ceacam3 T A 7: 17,158,371 N346K possibly damaging Het
Chd4 A G 6: 125,100,588 E74G probably damaging Het
Cntn1 A G 15: 92,295,011 M665V probably benign Het
Crtc2 C T 3: 90,261,041 Q364* probably null Het
Csf1r T A 18: 61,129,724 I857N probably damaging Het
Dner C T 1: 84,580,739 G168D probably damaging Het
Edar T C 10: 58,607,360 T315A probably benign Het
Egflam A G 15: 7,304,012 V153A probably damaging Het
Enoph1 T C 5: 100,063,823 I193T possibly damaging Het
Epc1 A G 18: 6,462,969 I9T probably damaging Het
Fbxw18 T A 9: 109,693,178 I208F possibly damaging Het
Gm4841 A G 18: 60,270,292 V243A probably benign Het
Herc2 T C 7: 56,219,786 V4297A probably damaging Het
Itsn2 C T 12: 4,627,960 P106S probably benign Het
Kcnu1 A G 8: 25,862,458 T218A probably damaging Het
Kif1a A G 1: 93,018,498 S1677P probably damaging Het
Krt14 A T 11: 100,204,700 M293K probably damaging Het
Meis3 T A 7: 16,184,064 V307E probably damaging Het
Nadk2 A C 15: 9,108,313 I417L probably benign Het
Nav2 AAGCAGCAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCAGCAGCA 7: 49,408,692 probably benign Het
Neb A T 2: 52,281,503 N1659K probably benign Het
Olfr1490 T C 19: 13,655,266 V274A probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr951 T C 9: 39,394,489 S233P probably damaging Het
Pde3b A T 7: 114,494,537 N339Y probably damaging Het
Phtf1 G A 3: 103,999,287 R606H probably damaging Het
Psd4 A G 2: 24,400,516 D535G possibly damaging Het
Rad51ap1 A G 6: 126,928,158 V130A probably damaging Het
Rbm11 T C 16: 75,596,586 F57L probably damaging Het
Rprd2 A G 3: 95,764,089 V1334A possibly damaging Het
Satb2 T C 1: 56,831,527 E433G probably damaging Het
Sema6b G A 17: 56,128,413 R277* probably null Het
Sepsecs A T 5: 52,647,673 S349T probably benign Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Slc7a2 T C 8: 40,915,030 probably null Het
Smc1b T A 15: 85,070,865 Y1062F probably benign Het
Snrnp70 G A 7: 45,377,052 R298* probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Taar8c A T 10: 24,101,348 C189S probably damaging Het
Tas1r2 T A 4: 139,655,361 D103E probably damaging Het
Timd2 T C 11: 46,677,260 I236V probably benign Het
Tmem87a A G 2: 120,377,926 V316A probably damaging Het
Treml2 T A 17: 48,300,573 L16Q probably damaging Het
Wdr66 A G 5: 123,322,563 D1196G probably benign Het
Zcchc14 G A 8: 121,608,598 probably benign Het
Zfp462 T C 4: 55,013,178 Y567H probably damaging Het
Zfp551 G A 7: 12,416,160 R441* probably null Het
Zfp930 A G 8: 69,226,721 I59M probably benign Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1436:Pde8b UTSW 13 95026170 missense probably benign 0.00
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R1879:Pde8b UTSW 13 95085215 missense possibly damaging 0.95
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R2892:Pde8b UTSW 13 95034259 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4623:Pde8b UTSW 13 95041939 missense possibly damaging 0.69
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5134:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5342:Pde8b UTSW 13 95041990 missense probably damaging 0.99
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5806:Pde8b UTSW 13 95042040 missense probably damaging 1.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATTAGCTCCCGTGGCATCC -3'
(R):5'- ACTGCAGTATGTGTGAGGGTAC -3'

Sequencing Primer
(F):5'- CCGGTTGGCATTGAAAATTAACCC -3'
(R):5'- GTACCACTCCTGCCAGATGAG -3'
Posted On2016-07-22