Incidental Mutation 'R5315:Sftpb'
ID405795
Institutional Source Beutler Lab
Gene Symbol Sftpb
Ensembl Gene ENSMUSG00000056370
Gene Namesurfactant associated protein B
SynonymsSftp-3, SP-B, SF-B, Sftp3
MMRRC Submission 042898-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72304610-72314371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72306892 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 158 (A158S)
Ref Sequence ENSEMBL: ENSMUSP00000138485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070437] [ENSMUST00000182014] [ENSMUST00000183018] [ENSMUST00000183278]
Predicted Effect probably benign
Transcript: ENSMUST00000070437
AA Change: A158S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066805
Gene: ENSMUSG00000056370
AA Change: A158S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
SapB 197 267 7.13e-10 SMART
SapB 292 361 2.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182014
AA Change: A158S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138204
Gene: ENSMUSG00000056370
AA Change: A158S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182765
SMART Domains Protein: ENSMUSP00000138298
Gene: ENSMUSG00000056370

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
Blast:SapB 43 91 1e-20 BLAST
PDB:2JOU|A 45 92 1e-7 PDB
SapB 116 185 2.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183018
AA Change: A158S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138695
Gene: ENSMUSG00000056370
AA Change: A158S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
Blast:SapB 197 245 3e-19 BLAST
PDB:2JOU|A 199 246 3e-7 PDB
SapB 270 339 2.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183278
AA Change: A158S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138485
Gene: ENSMUSG00000056370
AA Change: A158S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
PHENOTYPE: Inactivation of this gene results in respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Gm42669 A T 5: 107,508,237 I1301F probably damaging Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Nt5c2 T C 19: 46,892,243 Y353C probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr502 A G 7: 108,523,890 L20S probably damaging Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sh2d2a A C 3: 87,847,669 T23P probably damaging Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Slc4a1 T A 11: 102,358,254 I233F possibly damaging Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tbc1d14 T C 5: 36,507,588 D567G probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Zfp850 T C 7: 27,990,318 K155R probably benign Het
Other mutations in Sftpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Sftpb APN 6 72309862 missense probably benign 0.03
IGL02013:Sftpb APN 6 72305671 missense probably benign 0.08
R1741:Sftpb UTSW 6 72305813 missense probably benign 0.03
R2159:Sftpb UTSW 6 72309786 missense probably damaging 1.00
R5108:Sftpb UTSW 6 72304656 missense probably damaging 1.00
R5506:Sftpb UTSW 6 72304667 missense possibly damaging 0.46
R6415:Sftpb UTSW 6 72304649 missense probably damaging 0.96
R6622:Sftpb UTSW 6 72305655 missense possibly damaging 0.95
R7130:Sftpb UTSW 6 72305824 missense possibly damaging 0.89
R7342:Sftpb UTSW 6 72309875 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGATGCAGTACTTCACCCAGC -3'
(R):5'- CCTCCTAGTTTGAGCTCAGC -3'

Sequencing Primer
(F):5'- AGTACTTCACCCAGCCTGCTC -3'
(R):5'- AGTTTGAGCTCAGCCTCTCTGG -3'
Posted On2016-07-22