Incidental Mutation 'R5315:Zfp850'
ID405796
Institutional Source Beutler Lab
Gene Symbol Zfp850
Ensembl Gene ENSMUSG00000096916
Gene Namezinc finger protein 850
SynonymsC130069I09Rik, Gm4636
MMRRC Submission 042898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5315 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27984854-28014115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27990318 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 155 (K155R)
Ref Sequence ENSEMBL: ENSMUSP00000141063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099111] [ENSMUST00000180024] [ENSMUST00000180502]
Predicted Effect probably benign
Transcript: ENSMUST00000099111
Predicted Effect probably benign
Transcript: ENSMUST00000180024
AA Change: K155R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137192
Gene: ENSMUSG00000096916
AA Change: K155R

DomainStartEndE-ValueType
KRAB 14 75 1.56e-34 SMART
ZnF_C2H2 172 194 7.18e1 SMART
ZnF_C2H2 200 222 3.63e-3 SMART
ZnF_C2H2 228 250 8.94e-3 SMART
ZnF_C2H2 256 278 7.49e-5 SMART
ZnF_C2H2 313 335 1.01e-1 SMART
ZnF_C2H2 341 363 4.4e-2 SMART
ZnF_C2H2 369 391 7.37e-4 SMART
ZnF_C2H2 397 419 8.47e-4 SMART
ZnF_C2H2 425 447 1.92e-2 SMART
ZnF_C2H2 453 475 2.99e-4 SMART
ZnF_C2H2 481 503 7.78e-3 SMART
ZnF_C2H2 509 531 1.95e-3 SMART
ZnF_C2H2 537 559 1.92e-2 SMART
ZnF_C2H2 565 587 2.99e-4 SMART
ZnF_C2H2 593 615 1.79e-2 SMART
ZnF_C2H2 621 643 7.37e-4 SMART
ZnF_C2H2 649 671 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180502
AA Change: K155R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141063
Gene: ENSMUSG00000096916
AA Change: K155R

DomainStartEndE-ValueType
KRAB 14 75 6.5e-37 SMART
ZnF_C2H2 172 194 3e-1 SMART
ZnF_C2H2 200 222 1.5e-5 SMART
ZnF_C2H2 228 250 3.8e-5 SMART
ZnF_C2H2 256 274 2.5e-1 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik G A 3: 91,090,330 T26M possibly damaging Het
Ace3 T C 11: 105,994,921 V51A probably benign Het
Ass1 A T 2: 31,492,329 I171F probably benign Het
AU041133 T G 10: 82,151,672 Y386* probably null Het
Bex6 A G 16: 32,186,493 N40D probably benign Het
Cc2d2a A G 5: 43,720,433 Y1044C probably damaging Het
Cflar C G 1: 58,753,802 D442E probably benign Het
Dag1 A G 9: 108,209,117 V275A probably damaging Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Epha4 C T 1: 77,388,472 probably null Het
Eri2 T C 7: 119,786,018 D420G probably benign Het
Gm42669 A T 5: 107,508,237 I1301F probably damaging Het
Golga2 A G 2: 32,303,761 E463G probably damaging Het
Grsf1 G A 5: 88,673,775 probably benign Het
Igkv6-15 A C 6: 70,406,973 V7G possibly damaging Het
Katnal2 A T 18: 77,012,009 V143D probably benign Het
Mepce A C 5: 137,782,693 I617S probably damaging Het
Mms19 C T 19: 41,954,762 R320Q possibly damaging Het
Nt5c2 T C 19: 46,892,243 Y353C probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr502 A G 7: 108,523,890 L20S probably damaging Het
Pitpnm2 A T 5: 124,121,933 D1111E probably benign Het
Plin5 C A 17: 56,114,066 V200L probably benign Het
Rab3a T C 8: 70,755,922 F23L probably damaging Het
Rrp8 T C 7: 105,734,000 K353R probably benign Het
Senp7 A G 16: 56,180,526 D887G probably benign Het
Sftpb G T 6: 72,306,892 A158S probably benign Het
Sh2d2a A C 3: 87,847,669 T23P probably damaging Het
Siglecf T C 7: 43,355,108 L287P probably benign Het
Slc4a1 T A 11: 102,358,254 I233F possibly damaging Het
Spef2 T C 15: 9,596,691 Q1424R probably damaging Het
Tbc1d14 T C 5: 36,507,588 D567G probably damaging Het
Tmem106b T G 6: 13,081,560 N155K probably damaging Het
Vmn2r2 C A 3: 64,116,956 V735F probably benign Het
Other mutations in Zfp850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02278:Zfp850 APN 7 28008397 missense probably damaging 0.96
R0610:Zfp850 UTSW 7 27989394 missense probably damaging 0.99
R0690:Zfp850 UTSW 7 27985217 missense possibly damaging 0.67
R0711:Zfp850 UTSW 7 27990273 missense probably benign 0.00
R1310:Zfp850 UTSW 7 27989459 missense probably benign 0.40
R1594:Zfp850 UTSW 7 27989391 missense probably benign 0.00
R1771:Zfp850 UTSW 7 27985275 nonsense probably null
R2189:Zfp850 UTSW 7 27989055 missense probably benign 0.02
R2192:Zfp850 UTSW 7 27985195 missense probably damaging 1.00
R2417:Zfp850 UTSW 7 27989183 missense possibly damaging 0.54
R4321:Zfp850 UTSW 7 27989400 missense probably damaging 0.99
R4770:Zfp850 UTSW 7 27984986 unclassified probably null
R4970:Zfp850 UTSW 7 27990233 nonsense probably null
R5112:Zfp850 UTSW 7 27990233 nonsense probably null
R5166:Zfp850 UTSW 7 27990356 nonsense probably null
R5303:Zfp850 UTSW 7 28008413 missense probably damaging 1.00
R5496:Zfp850 UTSW 7 28007346 missense probably damaging 0.98
R5547:Zfp850 UTSW 7 27989419 missense probably damaging 1.00
R5677:Zfp850 UTSW 7 27989088 missense probably damaging 1.00
R5927:Zfp850 UTSW 7 27990195 missense probably benign 0.17
R6654:Zfp850 UTSW 7 27985215 nonsense probably null
R6950:Zfp850 UTSW 7 27990514 missense possibly damaging 0.86
R6987:Zfp850 UTSW 7 27990001 missense probably damaging 1.00
R6990:Zfp850 UTSW 7 27990376 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCTAGAACAGTGAAGGCAC -3'
(R):5'- CGGAAAATGCTTTAGAGTCAGG -3'

Sequencing Primer
(F):5'- CTGCCACATTCTTTACACTGAAAGGG -3'
(R):5'- TGGAATCAGATTATGAAGCTCAAC -3'
Posted On2016-07-22