Incidental Mutation 'R5316:Jph1'
ID405817
Institutional Source Beutler Lab
Gene Symbol Jph1
Ensembl Gene ENSMUSG00000042686
Gene Namejunctophilin 1
SynonymsENSMUSG00000054314, mitsugumin72, JP-1
MMRRC Submission 042899-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R5316 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location16964560-17097889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17091526 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 304 (Y304C)
Ref Sequence ENSEMBL: ENSMUSP00000039072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038382]
Predicted Effect probably damaging
Transcript: ENSMUST00000038382
AA Change: Y304C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039072
Gene: ENSMUSG00000042686
AA Change: Y304C

DomainStartEndE-ValueType
MORN 12 33 7.31e-1 SMART
MORN 36 56 7.6e1 SMART
MORN 58 79 2.49e-1 SMART
Pfam:MORN 82 99 8.9e-3 PFAM
MORN 104 125 3.72e-4 SMART
MORN 127 148 7.86e-3 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
MORN 279 300 2.07e-2 SMART
MORN 302 323 2.86e-5 SMART
low complexity region 382 400 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186604
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to suckle and die shortly after birth. Mutants exhibit deficiencies of triad junctions and contraction in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410015M20Rik G A 17: 56,609,649 S7L possibly damaging Het
Adam6b G A 12: 113,491,393 R610H probably damaging Het
Agap2 G A 10: 127,082,427 probably null Het
Apol10a A G 15: 77,488,529 T122A probably damaging Het
Arhgap17 G T 7: 123,296,527 A458D possibly damaging Het
Cd80 C T 16: 38,473,877 Q41* probably null Het
Cmss1 T G 16: 57,302,275 K252T probably damaging Het
Cog2 A G 8: 124,529,040 D122G probably benign Het
Dsc3 T A 18: 19,963,541 D841V possibly damaging Het
Dst C A 1: 34,223,848 Q4549K probably damaging Het
Efcab3 A G 11: 105,076,460 I5275M possibly damaging Het
Epha6 A G 16: 59,954,720 L711P probably damaging Het
Fam208a A G 14: 27,472,035 D1064G possibly damaging Het
Gabrg2 T A 11: 41,976,558 N78I probably damaging Het
Hist1h1a C T 13: 23,764,102 probably benign Het
Htra3 T C 5: 35,664,076 D319G probably damaging Het
Kat2a G T 11: 100,712,170 Q79K possibly damaging Het
Klhl7 C T 5: 24,127,750 A102V probably benign Het
Lamb3 A G 1: 193,330,193 H426R probably benign Het
Lemd3 C A 10: 120,952,256 probably null Het
Mcm3ap A C 10: 76,470,926 D291A possibly damaging Het
Mme C G 3: 63,368,954 F717L probably damaging Het
Mybpc2 T A 7: 44,520,382 K171* probably null Het
Naip6 T C 13: 100,283,782 N1327D probably benign Het
Nr2e1 A T 10: 42,571,491 M175K probably benign Het
Olfr160 A T 9: 37,711,685 V198D possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppef2 A T 5: 92,235,811 M480K probably benign Het
Prkar2b A T 12: 32,060,985 L33Q probably damaging Het
Ralgps2 A T 1: 156,813,497 V496E probably damaging Het
Rbms2 G A 10: 128,145,737 P81L probably damaging Het
Scara5 T C 14: 65,689,815 S54P possibly damaging Het
Slc18a3 T C 14: 32,462,857 D523G probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Srrt C A 5: 137,296,551 A747S probably benign Het
Sycp2 C T 2: 178,356,503 D1075N probably benign Het
Vat1l G A 8: 114,284,348 V279I probably damaging Het
Zfp677 A G 17: 21,397,148 K156E probably damaging Het
Other mutations in Jph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Jph1 APN 1 17091740 missense probably damaging 1.00
IGL01382:Jph1 APN 1 17016156 missense probably damaging 1.00
IGL01936:Jph1 APN 1 17097384 missense probably damaging 0.98
IGL02012:Jph1 APN 1 17097414 missense probably benign 0.00
IGL02142:Jph1 APN 1 17091660 missense probably damaging 0.99
IGL02212:Jph1 APN 1 17091757 missense probably damaging 1.00
IGL02317:Jph1 APN 1 17003923 missense probably benign
IGL02450:Jph1 APN 1 17003977 missense possibly damaging 0.77
IGL02707:Jph1 APN 1 17004451 missense probably benign
R0668:Jph1 UTSW 1 17091671 missense probably damaging 1.00
R0893:Jph1 UTSW 1 17004283 nonsense probably null
R1308:Jph1 UTSW 1 17091694 missense probably damaging 1.00
R1318:Jph1 UTSW 1 16997490 missense probably damaging 1.00
R1495:Jph1 UTSW 1 17091652 missense probably benign
R1712:Jph1 UTSW 1 17097232 missense possibly damaging 0.57
R1916:Jph1 UTSW 1 17092055 missense probably damaging 1.00
R4492:Jph1 UTSW 1 16997546 missense probably damaging 1.00
R4559:Jph1 UTSW 1 17004511 missense probably benign
R4565:Jph1 UTSW 1 17004202 missense possibly damaging 0.91
R4694:Jph1 UTSW 1 16997505 missense probably damaging 0.98
R4700:Jph1 UTSW 1 17091704 missense possibly damaging 0.82
R4906:Jph1 UTSW 1 17091611 missense probably damaging 1.00
R5029:Jph1 UTSW 1 17091391 missense possibly damaging 0.85
R5256:Jph1 UTSW 1 17091398 missense probably benign 0.38
R5691:Jph1 UTSW 1 17004363 missense probably benign 0.21
R6209:Jph1 UTSW 1 17097586 missense probably damaging 0.98
R6380:Jph1 UTSW 1 17091847 missense probably damaging 1.00
R6645:Jph1 UTSW 1 17091761 missense probably damaging 1.00
R6829:Jph1 UTSW 1 17004423 missense probably damaging 1.00
R7007:Jph1 UTSW 1 17004186 missense possibly damaging 0.85
R7276:Jph1 UTSW 1 17092042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTTGGTTCTGGCCATGG -3'
(R):5'- TCTTCCATCTCCAGCAAGCG -3'

Sequencing Primer
(F):5'- TTCTGGCCATGGCTGCC -3'
(R):5'- GCCATGAGCAGAATCAGTTCTAGC -3'
Posted On2016-07-22