Incidental Mutation 'R5319:Ptpn6'
ID405978
Institutional Source Beutler Lab
Gene Symbol Ptpn6
Ensembl Gene ENSMUSG00000004266
Gene Nameprotein tyrosine phosphatase, non-receptor type 6
SynonymsHcph, hcp, SHP-1, Ptp1C
MMRRC Submission 042902-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R5319 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124720707-124738714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124732950 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 2 (V2M)
Ref Sequence ENSEMBL: ENSMUSP00000108103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000173647] [ENSMUST00000174265]
Predicted Effect probably benign
Transcript: ENSMUST00000004377
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112484
AA Change: V2M

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: V2M

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171549
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173228
Predicted Effect probably benign
Transcript: ENSMUST00000173647
AA Change: V2M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133747
Gene: ENSMUSG00000004266
AA Change: V2M

DomainStartEndE-ValueType
SH2 2 64 2.35e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174265
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174861
Meta Mutation Damage Score 0.0468 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,504,696 S218P probably benign Het
A430078G23Rik T C 8: 3,385,010 probably null Het
Ahctf1 A C 1: 179,769,050 S121A probably damaging Het
Anpep C T 7: 79,841,731 R174H probably benign Het
Becn1 A G 11: 101,288,803 probably benign Het
Cabin1 T C 10: 75,725,715 Y984C probably damaging Het
Cacna2d4 G T 6: 119,347,252 probably null Het
Ccdc14 T G 16: 34,723,172 N681K probably damaging Het
Cdk5rap1 T A 2: 154,335,569 T577S possibly damaging Het
Clca4b T C 3: 144,925,179 R307G possibly damaging Het
Colgalt2 A G 1: 152,484,869 Q219R possibly damaging Het
Cops3 A T 11: 59,827,936 D177E possibly damaging Het
Cyp2d9 T C 15: 82,454,055 Y127H probably damaging Het
Dnajc11 A G 4: 151,968,526 T98A probably damaging Het
Dst T C 1: 34,225,977 S4757P possibly damaging Het
Dvl2 C T 11: 70,008,131 T448I possibly damaging Het
E230016K23Rik T G 11: 83,621,670 noncoding transcript Het
Efl1 G T 7: 82,674,506 D219Y probably damaging Het
Epha10 T A 4: 124,914,000 S615T probably benign Het
Fbxw22 T A 9: 109,383,947 T311S possibly damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Fshb T A 2: 107,058,879 I27F probably damaging Het
Gm340 G A 19: 41,586,352 G1182D probably damaging Het
Gm8521 A T Y: 3,859,335 noncoding transcript Het
Gpr45 T C 1: 43,032,838 S214P probably damaging Het
Hgf G A 5: 16,566,862 probably null Het
Hs6st1 T C 1: 36,104,178 V398A probably benign Het
Ighmbp2 A G 19: 3,271,646 V371A probably damaging Het
Kif18a T A 2: 109,318,025 N621K probably benign Het
Lama5 A G 2: 180,181,118 F2785S probably damaging Het
Lrriq3 T C 3: 155,129,471 I281T possibly damaging Het
Macf1 C T 4: 123,473,436 A2511T probably damaging Het
Mark4 T C 7: 19,436,961 D328G possibly damaging Het
Myo1c G A 11: 75,662,026 E434K possibly damaging Het
Nfe2l1 A G 11: 96,819,379 S387P probably damaging Het
Nr1d2 A G 14: 18,215,197 S272P probably benign Het
Nsrp1 T C 11: 77,049,467 H104R probably damaging Het
Odf1 T A 15: 38,219,619 S64T probably benign Het
Olfr1204 T A 2: 88,852,778 I276K probably damaging Het
Olfr223 A T 11: 59,589,651 V146E probably damaging Het
Olfr843 C T 9: 19,249,033 R122H possibly damaging Het
Pde4b C A 4: 102,421,788 D6E probably benign Het
Phox2a C T 7: 101,820,850 T96M probably damaging Het
Plg A G 17: 12,403,227 E478G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r12c T A 7: 4,483,984 T517S probably benign Het
Ptk7 C T 17: 46,572,677 V821M probably damaging Het
Rgl2 T C 17: 33,933,555 V380A probably benign Het
Rpl13a-ps1 A G 19: 50,030,152 V195A possibly damaging Het
Rsph1 C A 17: 31,273,377 V72F probably benign Het
Sh3bp4 T C 1: 89,145,350 V640A probably benign Het
Simc1 T A 13: 54,524,982 V381E probably benign Het
Slc15a3 A T 19: 10,855,932 T438S probably damaging Het
Slc5a4b C T 10: 76,062,399 V494M probably benign Het
Sos2 C A 12: 69,627,284 R335L probably benign Het
Trp53i13 A T 11: 77,508,740 N254K probably damaging Het
Trpc6 A G 9: 8,609,921 Y130C probably damaging Het
Trpv1 A G 11: 73,239,589 I174V probably damaging Het
Tsnax T A 8: 125,015,719 D62E probably damaging Het
Vezt T A 10: 93,970,331 E739D probably benign Het
Vmn1r59 T A 7: 5,454,210 I184F probably damaging Het
Yeats2 T C 16: 20,186,425 V385A probably benign Het
Other mutations in Ptpn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 unclassified probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
spin UTSW 6 124728559 missense probably damaging 0.99
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCACCCTGGTTCTTGCG -3'
(R):5'- GTTCTAGTGAGTTCCCCTAAGG -3'

Sequencing Primer
(F):5'- GTTCTTGCGGCTGGGCC -3'
(R):5'- TGTCTCCGCCCTGCTGG -3'
Posted OnJul 22, 2016