Incidental Mutation 'R5320:Gtf3c3'
ID406024
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54405873 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 674 (L674Q)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably damaging
Transcript: ENSMUST00000041638
AA Change: L674Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: L674Q

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGATTGCAGGGCTGACAC -3'
(R):5'- CGAGTGTCTTGCCGAAAGAAG -3'

Sequencing Primer
(F):5'- GGCTGACACCATTTGCAGATC -3'
(R):5'- GAAGACTGGTGGAACCTTCTC -3'
Posted On2016-07-22