Incidental Mutation 'R5320:Ralgds'
ID406027
Institutional Source Beutler Lab
Gene Symbol Ralgds
Ensembl Gene ENSMUSG00000026821
Gene Nameral guanine nucleotide dissociation stimulator
SynonymsRalGDS, Gnds, Rgds
MMRRC Submission 042903-MU
Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28513125-28553081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28545212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 405 (I405T)
Ref Sequence ENSEMBL: ENSMUSP00000028170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000135803] [ENSMUST00000140704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028170
AA Change: I405T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821
AA Change: I405T

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100241
AA Change: I460T

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821
AA Change: I460T

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113893
AA Change: I448T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821
AA Change: I448T

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130281
Predicted Effect probably benign
Transcript: ENSMUST00000135803
SMART Domains Protein: ENSMUSP00000115092
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 127 2.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137215
SMART Domains Protein: ENSMUSP00000116215
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 1 107 5.55e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137513
Predicted Effect probably benign
Transcript: ENSMUST00000140704
SMART Domains Protein: ENSMUSP00000118966
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
RA 36 123 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146217
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pcsk9 A T 4: 106,463,791 D40E probably benign Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Ralgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ralgds APN 2 28552218 missense probably damaging 1.00
IGL01774:Ralgds APN 2 28550542 nonsense probably null
IGL02747:Ralgds APN 2 28548110 unclassified probably benign
IGL03135:Ralgds APN 2 28549088 missense probably damaging 0.99
PIT4458001:Ralgds UTSW 2 28542474 missense probably damaging 1.00
PIT4531001:Ralgds UTSW 2 28545214 nonsense probably null
R0049:Ralgds UTSW 2 28542379 synonymous silent
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0285:Ralgds UTSW 2 28550569 splice site probably null
R0665:Ralgds UTSW 2 28545206 missense probably damaging 0.98
R0718:Ralgds UTSW 2 28549116 missense probably benign 0.37
R1755:Ralgds UTSW 2 28550546 missense probably damaging 0.99
R1966:Ralgds UTSW 2 28545875 missense probably damaging 0.96
R2873:Ralgds UTSW 2 28548769 splice site probably null
R2874:Ralgds UTSW 2 28548769 splice site probably null
R4082:Ralgds UTSW 2 28552271 utr 3 prime probably benign
R4342:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4344:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4647:Ralgds UTSW 2 28545520 critical splice donor site probably null
R4738:Ralgds UTSW 2 28545416 missense probably damaging 1.00
R4762:Ralgds UTSW 2 28552152 missense probably damaging 0.97
R5027:Ralgds UTSW 2 28552090 critical splice acceptor site probably null
R5738:Ralgds UTSW 2 28542526 intron probably benign
R5969:Ralgds UTSW 2 28542414 missense probably damaging 1.00
R6014:Ralgds UTSW 2 28543661 missense probably damaging 0.97
R6136:Ralgds UTSW 2 28550565 critical splice donor site probably null
R6137:Ralgds UTSW 2 28547588 missense probably damaging 0.99
R6583:Ralgds UTSW 2 28533644 missense probably damaging 0.99
R6618:Ralgds UTSW 2 28550511 missense probably benign 0.09
R6801:Ralgds UTSW 2 28548436 missense probably damaging 1.00
R7046:Ralgds UTSW 2 28540729 missense probably damaging 1.00
R7095:Ralgds UTSW 2 28549308 missense possibly damaging 0.83
R7276:Ralgds UTSW 2 28545872 missense probably damaging 1.00
R7399:Ralgds UTSW 2 28543655 missense possibly damaging 0.95
X0028:Ralgds UTSW 2 28548699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCGTGCCCTACCACTG -3'
(R):5'- GAAATTCTTGAGCGCTCTGC -3'

Sequencing Primer
(F):5'- ACTGCCTGGGCTCCATCTG -3'
(R):5'- TCTGCACTCCTGGGGACAAG -3'
Posted On2016-07-22