Incidental Mutation 'R5320:Pcsk9'
ID406036
Institutional Source Beutler Lab
Gene Symbol Pcsk9
Ensembl Gene ENSMUSG00000044254
Gene Nameproprotein convertase subtilisin/kexin type 9
SynonymsNarc1
MMRRC Submission 042903-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5320 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106442329-106464329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106463791 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 40 (D40E)
Ref Sequence ENSEMBL: ENSMUSP00000055757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049507]
Predicted Effect probably benign
Transcript: ENSMUST00000049507
AA Change: D40E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254
AA Change: D40E

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Peptidase_S8 180 438 3.1e-34 PFAM
low complexity region 471 481 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an autocatalytic processing event with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. It is expressed in liver, intestine and kidney tissues and escorts specific receptors for lysosomal degradation. It plays a role in cholesterol and fatty acid metabolism. Mutations in this gene have been associated with autosomal dominant familial hypercholesterolemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice exhibit increased clearance of circulating cholesterol and decreased plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,567 I581N probably damaging Het
Abcb10 A G 8: 123,971,024 F187S probably benign Het
Actl11 T A 9: 107,931,004 V842E possibly damaging Het
Akap12 A G 10: 4,357,291 D1367G probably benign Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bmpr1a C T 14: 34,425,042 V258M probably damaging Het
Bptf T A 11: 107,081,367 K892* probably null Het
Cap2 A G 13: 46,648,364 *422W probably null Het
Cars2 G T 8: 11,517,854 H414N probably benign Het
Ccnt1 A C 15: 98,544,243 S381R probably benign Het
Cdyl2 A T 8: 116,595,055 C244* probably null Het
Cers2 A G 3: 95,320,994 E115G probably null Het
Cpt1b G A 15: 89,419,274 P553S probably benign Het
Cuedc1 A G 11: 88,177,310 E128G probably damaging Het
Dll4 T A 2: 119,326,487 V80D probably damaging Het
Dopey2 T C 16: 93,739,986 L113P probably damaging Het
Doxl2 T A 6: 48,975,540 L133Q probably damaging Het
Fam98a A G 17: 75,538,815 I312T probably damaging Het
Gnrhr T G 5: 86,197,614 K71T possibly damaging Het
Gtf3c3 A T 1: 54,405,873 L674Q probably damaging Het
Hipk2 A T 6: 38,818,277 H352Q probably damaging Het
Hivep1 T C 13: 42,159,639 V1785A probably damaging Het
Hspa4 A T 11: 53,262,983 I687N probably damaging Het
Krt18 A T 15: 102,028,520 D81V probably damaging Het
Lama3 A C 18: 12,552,855 D1142A probably damaging Het
Lnpep A G 17: 17,546,465 I713T possibly damaging Het
Man2b2 T A 5: 36,810,333 Y897F probably damaging Het
Muc5b A T 7: 141,859,001 I1895F unknown Het
Myh8 G A 11: 67,286,263 V414I probably damaging Het
Myo1d A T 11: 80,684,323 probably null Het
Nav2 A T 7: 49,491,373 M889L probably benign Het
Oc90 C T 15: 65,882,608 G236D probably benign Het
Olfr60 A G 7: 140,345,635 V118A probably benign Het
Pak4 A G 7: 28,568,206 I11T probably damaging Het
Papss2 T C 19: 32,638,387 I173T probably damaging Het
Pdzrn3 G C 6: 101,151,103 H867Q probably damaging Het
Plcb1 A T 2: 135,252,776 I174F possibly damaging Het
Pom121l2 G A 13: 21,981,845 W95* probably null Het
Prcp A T 7: 92,928,635 T336S probably benign Het
Prdm11 A C 2: 93,012,881 S78A probably benign Het
Ralgds T C 2: 28,545,212 I405T probably damaging Het
Rasgrf1 A G 9: 90,020,425 R1208G probably damaging Het
Rasgrp2 T A 19: 6,408,834 probably null Het
Rb1 A T 14: 73,213,126 Y599* probably null Het
Rnf141 A T 7: 110,833,803 F62L probably damaging Het
Rsl24d1 T A 9: 73,116,416 F292I possibly damaging Het
Scn10a C T 9: 119,648,109 V736I probably damaging Het
Sim2 A T 16: 94,104,739 T141S probably benign Het
Slc6a15 G T 10: 103,408,206 V436L probably damaging Het
Smarca2 T C 19: 26,691,372 S924P probably damaging Het
Svs1 T A 6: 48,987,575 F172L probably benign Het
Tacc1 T C 8: 25,181,865 E449G probably benign Het
Tlr3 A T 8: 45,399,100 N253K possibly damaging Het
Tmem198 G A 1: 75,479,856 A82T probably benign Het
Tom1l2 A T 11: 60,242,822 L54* probably null Het
Trav12-2 A G 14: 53,616,899 Y110C probably benign Het
Trdn T A 10: 33,333,251 probably null Het
Trim36 G T 18: 46,167,498 P690Q probably damaging Het
Trpc4 A T 3: 54,299,178 M600L probably damaging Het
Trpm2 T A 10: 77,923,521 Q1143L probably benign Het
Usp34 T A 11: 23,333,739 D144E probably benign Het
Vps18 A T 2: 119,297,377 R894* probably null Het
Vwa1 A G 4: 155,770,912 V248A probably benign Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Other mutations in Pcsk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Pcsk9 APN 4 106454646 missense probably benign 0.00
IGL02709:Pcsk9 APN 4 106447689 splice site probably benign
IGL02804:Pcsk9 APN 4 106456964 missense probably damaging 1.00
IGL02850:Pcsk9 APN 4 106458865 missense probably damaging 1.00
IGL03009:Pcsk9 APN 4 106454345 missense probably damaging 1.00
IGL03294:Pcsk9 APN 4 106446770 missense probably benign
R0271:Pcsk9 UTSW 4 106449049 splice site probably benign
R0321:Pcsk9 UTSW 4 106444694 missense probably benign
R0413:Pcsk9 UTSW 4 106454341 missense probably damaging 1.00
R0426:Pcsk9 UTSW 4 106450077 missense possibly damaging 0.77
R0783:Pcsk9 UTSW 4 106450117 missense probably benign 0.00
R2136:Pcsk9 UTSW 4 106446770 missense probably benign 0.00
R4056:Pcsk9 UTSW 4 106444702 missense probably benign 0.02
R4438:Pcsk9 UTSW 4 106458959 missense probably benign 0.00
R4683:Pcsk9 UTSW 4 106458895 missense possibly damaging 0.59
R4739:Pcsk9 UTSW 4 106447156 missense probably damaging 1.00
R4801:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R4802:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R5249:Pcsk9 UTSW 4 106463753 missense probably benign 0.01
R5307:Pcsk9 UTSW 4 106447174 missense probably damaging 1.00
R5653:Pcsk9 UTSW 4 106458916 missense probably damaging 1.00
R5827:Pcsk9 UTSW 4 106448947 missense probably damaging 1.00
R6010:Pcsk9 UTSW 4 106454272 missense possibly damaging 0.92
R6019:Pcsk9 UTSW 4 106456876 missense probably benign 0.02
R6393:Pcsk9 UTSW 4 106447596 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGAGACCACCAGACGGCTAG -3'
(R):5'- TTCTGAGGCTAGAGGACTGAG -3'

Sequencing Primer
(F):5'- CCACCAGACGGCTAGATGAG -3'
(R):5'- AGTCCTTGGCTCCCCAGAG -3'
Posted On2016-07-22